Phospholipase A2 (PLB1) (NM_153021) Human Untagged Clone

CAT#: SC306540

Reviews ()
Write a review

PLB1 (untagged)-Human phospholipase B1 (PLB1), transcript variant 1



Reconstitution Protocol

USD 1,373.00

3 Weeks*

Size
    • 10 ug

Product images

Other products for "PLB1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PLB1
Synonyms PLB; PLB/LIP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306540 representing NM_153021.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGCTGCGGCCAGGCATTTTCCTCCTGGAGCTGCTGCTGCTTCTGGGGCAAGGGACCCCTCAGATC
CATACCTCTCCTAGAAAGAGTACATTGGAAGGGCAGCTATGGCCAGAGACCCTGAAGAATTCTCCATTC
CCATGCAACCCAAATAAATTAGGAGTGAATATGCCTTCTAAATCAGTTCACTCTCTGAAGCCTTCTGAT
ATTAAATTTGTGGCAGCCATTGGCAATCTGGAAATTCCTCCAGACCCAGGGACGGGCGATCTGGAGAAG
CAAGACTGGACTGAAAGGCCACAGCAGGTGTGCATGGGAGTGATGACAGTCCTTTCAGACATCATCAGA
TATTTCAGTCCTTCTGTTCCAATGCCTGTGTGCCACACTGGAAAGAGAGTCATACCCCACGATGGTGCT
GAAGACTTGTGGATTCAGGCTCAAGAACTGGTGAGAAACATGAAAGAGAACCTGCAACTTGACTTTCAA
TTTGACTGGAAGCTCATCAATGTGTTCTTCAGTAATGCAAGCCAGTGTTACCTGTGCCCCTCTGCTCAA
CAGAATGGGCTTGCGGCGGGCGGCGTGGATGAGCTGATGGGGGTGCTGGACTACCTGCAGCAGGAGGTC
CCCAGAGCATTTGTAAACCTGGTGGACCTCTCTGAGGTTGCAGAGGTCTCTCGTCAGTATCACGGCACT
TGGCTCAGCCCTGCACCAGAGCCCTGTAATTGCTCAGAGGAGACCACCCGGCTGGCCAAGGTGGTGATG
CAGTGGTCTTATCAGGAAGCCTGGAACAGCCTCCTGGCCTCCAGCAGGTACAGTGAGCAGGAGTCCTTC
ACCGTGGTTTTCCAGCCTTTCTTCTATGAGACCACCCCATCTCTACACTCGGAGGACCCCCGACTCCAG
GATTCTACCACGCTGGCCTGGCATCTCTGGAATAGGATGATGGAGCCAGCAGGAGAGAAAGATGAGCCA
TTGAGTGTAAAACACGGGAGGCCAATGAAGTGTCCCTCTCAGGAGAGCCCCTATCTGTTCAGCTACAGA
AACAGCAACTACCTGACCAGACTGCAGAAACCCCAAGACAAGCTTGAGGTAAGAGAAGGAGCGGAAATC
AGATGTCCTGACAAAGACCCCTCCGATACGGTTCCCACCTCAGTTCATAGGCTGAAGCCGGCTGACATC
AACGTAATTGGAGCCCTGGGTGACTCTCTCACGGCAGGCAATGGGGCCGGGTCCACACCTGGGAACGTC
TTGGACGTCTTGACTCAGTACCGAGGCCTGTCCTGGAGCGTCGGCGGAGATGAGAACATCGGCACCGTT
ACCACCCTGGCGAACATCCTCCGGGAATTCAACCCTTCCCTGAAGGGCTTCTCTGTTGGCACTGGGAAA
GAAACCAGTCCTAATGCCTTCTTAAACCAGGCTGTGGCAGGAGGCCGAGCTGAGGATCTACCTGTCCAG
GCCAGGAGGCTGGTGGACCTGATGAAGAATGACACGAGGATACACTTTCAGGAAGACTGGAAGATAATA
ACCCTGTTTATAGGCGGCAATGACCTCTGTGATTTCTGCAATGATCTGGTCCACTATTCTCCCCAGAAC
TTCACAGACAACATTGGAAAGGCCCTGGACATCCTCCATGCTGAGGTTCCTCGGGCATTTGTGAACCTG
GTGACGGTGCTTGAGATCGTCAACCTGAGGGAGCTGTACCAGGAGAAAAAAGTCTACTGCCCAAGGATG
ATCCTCAGGTCTCTGTGTCCCTGTGTCCTGAAGTTTGATGATAACTCAACAGAACTTGCTACCCTCATC
GAATTCAACAAGAAGTTTCAGGAGAAGACCCACCAACTGATTGAGAGTGGGCGATATGACACAAGGGAA
GATTTTACTGTGGTTGTGCAGCCGTTCTTTGAAAACGTGGACATGCCAAAGACCTCGGAAGGATTGCCT
GACAACTCTTTCTTCGCTCCTGACTGTTTCCACTTCAGCAGCAAGTCTCACTCCCGAGCAGCCAGTGCT
CTCTGGAACAATATGCTGGAGCCTGTTGGCCAGAAGACGACTCGTCATAAGTTTGAAAACAAGATCAAT
ATCACATGTCCGAACCAGGTCCAGCCGTTTCTGAGGACCTACAAGAACAGCATGCAGGGTCATGGGACC
TGGCTGCCATGCAGGGACAGAGCCCCTTCTGCCTTGCACCCTACCTCAGTGCATGCCCTGAGACCTGCA
GACATCCAAGTTGTGGCTGCTCTGGGGGATTCTCTGACCGCTGGCAATGGAATTGGCTCCAAACCAGAC
GACCTCCCCGATGTCACCACACAGTATCGGGGACTGTCATACAGTGCAGGAGGGGACGGCTCCCTGGAG
AATGTGACCACCTTACCTAATATCCTTCGGGAGTTTAACAGAAACCTCACAGGCTACGCCGTGGGCACG
GGTGATGCCAATGACACGAATGCATTCCTCAATCAAGCTGTTCCCGGAGCAAAGGCTGAGGATCTTATG
AGCCAAGTCCAAACTCTGATGCAGAAGATGAAAGATGATCATAGAGTAAATTTCCATGAAGACTGGAAG
GTCATCACAGTGCTGATCGGAGGCAGCGATTTATGTGACTACTGCACAGATTCGAATCTGTATTCTGCA
GCCAACTTTGTTCACCATCTCCGCAATGCCTTGGACGTCCTGCATAGAGAGGTGCCCAGAGTCCTGGTC
AACCTCGTGGACTTCCTGAACCCCACTATCATGCGGCAGGTGTTCCTGGGAAACCCAGACAAGTGCCCA
GTGCAGCAGGCCAGCGTTTTGTGTAACTGCGTTCTGACCCTGCGGGAGAACTCCCAAGAGCTAGCCAGG
CTGGAGGCCTTCAGCCGAGCCTACCGGAGCAGCATGCGCGAGCTGGTGGGGTCAGGCCGCTATGACACG
CAGGAGGACTTCTCTGTGGTGCTGCAGCCCTTCTTCCAGAACATCCAGCTCCCTGTCCTGGCGGATGGG
CTCCCAGATACGTCCTTCTTTGCCCCAGACTGCATCCACCCAAATCAGAAATTCCACTCCCAGCTGGCC
AGAGCCCTTTGGACCAATATGCTTGAACCACTTGGAAGCAAAACAGAGACCCTGGACCTGAGAGCAGAG
ATGCCCATCACCTGTCCCACTCAGAATGAGCCCTTCCTGAGAACCCCTCGGAATAGTAACTACACGTAC
CCCATCAAGCCAGCCATTGAGAACTGGGGCAGTGACTTCCTGTGTACAGAGTGGAAGGCTTCCAATAGT
GTTCCAACCTCTGTCCACCAGCTCCGACCAGCAGACATCAAAGTGGTGGCCGCCCTGGGTGACTCTCTG
ACTACAGCAGTGGGAGCTCGACCAAACAACTCCAGTGACCTACCCACATCTTGGAGGGGACTCTCTTGG
AGCATTGGAGGGGATGGGAACTTGGAGACTCACACCACACTGCCCAACATTCTGAAGAAGTTCAACCCT
TACCTCCTTGGCTTCTCTACCAGCACCTGGGAGGGGACAGCAGGACTAAATGTGGCAGCGGAAGGGGCC
AGAGCTAGGGACATGCCAGCCCAGGCCTGGGACCTGGTAGAGCGAATGAAAAACAGCCCCGACATCAAC
CTGGAGAAAGACTGGAAGCTGGTCACACTCTTCATTGGGGTCAACGACTTGTGTCATTACTGTGAGAAT
CCGGAGGCCCACTTGGCCACGGAATATGTTCAGCACATCCAACAGGCCCTGGACATCCTCTCTGAGGAG
CTCCCAAGGGCTTTCGTCAACGTGGTGGAGGTCATGGAGCTGGCTAGCCTGTACCAGGGCCAAGGCGGG
AAATGTGCCATGCTGGCAGCTCAGAACAACTGCACTTGCCTCAGACACTCGCAAAGCTCCCTGGAGAAG
CAAGAACTGAAGAAAGTGAACTGGAACCTCCAGCATGGCATCTCCAGTTTCTCCTACTGGCACCAATAC
ACACAGCGTGAGGACTTTGCGGTTGTGGTGCAGCCTTTCTTCCAAAACACACTCACCCCACTGAACGAG
AGAGGGGACACTGACCTCACCTTCTTCTCCGAGGACTGTTTTCACTTCTCAGACCGCGGGCATGCCGAG
ATGGCCATCGCACTCTGGAACAACATGCTGGAACCAGTGGGCCGCAAGACTACCTCCAACAACTTCACC
CACAGCCGAGCCAAACTCAAGTGCCCCTCTCCTGAGAGCCCTTACCTCTACACCCTGCGGAACAGCCGA
TTGCTCCCAGACCAGGCTGAAGAAGCCCCCGAGGTGCTCTACTGGGCTGTCCCAGTGGCAGCGGGAGTC
GGCCTTGTGGTGGGCATCATCGGGACAGTGGTCTGGAGGTGCAGGAGAGGTGGCCGGAGGGAAGATCCT
CCAATGAGCCTGCGCACTGTGGCCCTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_153021
Insert Size 4377 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153021.4
RefSeq Size 5148 bp
RefSeq ORF 4377 bp
Locus ID 151056
UniProt ID Q6P1J6
Cytogenetics 2p23.2
Protein Families Transmembrane
MW 163.1 kDa
Gene Summary This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.