Sphingosine 1 phosphate phosphatase 2 (SGPP2) (NM_152386) Human Untagged Clone

SKU
SC306384
SGPP2 (untagged)-Human sphingosine-1-phosphate phosphatase 2 (SGPP2)
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Sphingosine 1 phosphate phosphatase 2
Synonyms SPP2; SPPase2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_152386 edited
ATGGCCGAGCTGCTGCGGAGCCTGCAGGATTCCCAGCTCGTCGCCCGCTTCCAGCGCCGC
TGCGGGCTCTTCCCCGCTCCGGATGAAGGCCCCCGGGAGAACGGCGCGGACCCCACGGAG
CGCGCGGCGCGGGTCCCCGGGGTCGAGCATCTCCCCGCAGCCAACGGCAAGGGCGGCGAG
GCTCCGGCCAACGGGCTGCGCAGAGCCGCGGCGCCGGAGGCTTATGTACAGAAGTACGTC
GTGAAGAATTATTTCTACTATTACCTATTCCAATTTTCAGCTGCTTTGGGCCAAGAAGTG
TTCTACATCACGTTTCTTCCATTCACTCACTGGAATATTGACCCTTATTTATCCAGAAGA
TTGATCATCATATGGGTTTTGGTGATGTATATTGGCCAAGTGGCCAAGGATGTCTTGAAG
TGGCCCCGTCCCTCCTCCCCTCCAGTTGTGAAACTGGAAAAGAGACTGATTGCTGAATAT
GGAATGCCATCCACCCACGCCATGGCGGCCACTGCCATTGCCTTCACCCTCCTTATCTCT
ACTATGGACAGATACCAGTATCCATTTGTGTTGGGACTGGTGATGGCCGTGGTGTTTTCC
ACCTTGGTGTGTCTCAGCAGGCTCTACACTGGGATGCATACGGTCCTGGATGTGCTGGGT
GGCGTCCTGATCACCGCACTCCTCATCGTCCTCACCTACCCTGCCTGGACCTTCATCGAC
TGCCTGGACTCGGCCAGCCCCCTCTTCCCCGTGTGTGTCATAGTTGTGCCATTCTTCCTG
TGTTACAATTACCCTGTTTCTGATTACTACAGCCCAACCCGGGCGGACACCACCACCATT
CTGGCTGCCGGGGCTGGAGTGACCATAGGATTCTGGATCAACCATTTCTTCCAGCTTGTA
TCCAAGCCCGCTGAATCTCTCCCTGTTATTCAGAACATCCCACCGCTCACCACCTACATG
TTAGTTTTGGGTCTGACCAAATTTGCAGTGGGAATTGTGTTGATCCTCTTGGTTCGTCAG
CTTGTACAAAATCTCTCACTGCAAGTATTATACTCATGGTTCAAGGTGGTCACCAGGAAC
AAGGAGGCCAGGCGGAGACTGGAGATTGAAGTGCCTTACAAGTTTGTTACCTACACATCT
GTTGGCATCTGCGCTACAACCTTTGTGCCGATGCTTCACAGGTTTCTGGGATTACCCTGA
Restriction Sites Please inquire
ACCN NM_152386
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_152386.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152386.2, NP_689599.2
RefSeq Size 1200 bp
RefSeq ORF 1200 bp
Locus ID 130367
UniProt ID Q8IWX5
Cytogenetics 2q36.1
Protein Families Transmembrane
Protein Pathways Sphingolipid metabolism
Summary The protein encoded by this gene is a transmembrane protein that degrades the bioactive signaling molecule sphingosine 1-phosphate. The encoded protein is induced during inflammatory responses and has been shown to be downregulated by the microRNA-31 tumor suppressor. Alternative splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (1) encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Sphingosine 1 phosphate phosphatase 2 (SGPP2) (NM_152386) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217993 SGPP2 (Myc-DDK-tagged)-Human sphingosine-1-phosphate phosphatase 2 (SGPP2) 10 ug
$457.00
RC217993L3 Lenti ORF clone of Human sphingosine-1-phosphate phosphatase 2 (SGPP2), Myc-DDK-tagged 10 ug
$757.00
RC217993L4 Lenti ORF clone of Human sphingosine-1-phosphate phosphatase 2 (SGPP2), mGFP tagged 10 ug
$757.00
RG217993 SGPP2 (tGFP-tagged) - Human sphingosine-1-phosphate phosphatase 2 (SGPP2) 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.