TAF15 (NM_139215) Human Untagged Clone
SKU
SC306134
TAF15 (untagged)-Human TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa (TAF15), transcript variant 1
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | TAF15 |
Synonyms | Npl3; RBP56; TAF2N; TAFII68 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_139215, the custom clone sequence may differ by one or more nucleotides
ATGTCGGATTCTGGAAGTTACGGTCAGTCTGGGGGTGAGCAGCAAAGTTATTCTACCTATGGAAATCCAG GCAGCCAAGGCTATGGACAAGCATCACAAAGCTATTCTGGCTATGGGCAAACGACTGATTCCTCTTATGG ACAGAACTACAGCGGTTACTCCAGTTATGGACAAAGTCAGTCAGGTTATTCACAGTCCTATGGTGGTTAT GAGAATCAAAAGCAGAGCTCATATAGCCAGCAACCATATAATAACCAGGGACAGCAGCAAAACATGGAAT CATCAGGAAGCCAAGGTGGAAGAGCACCTTCCTATGACCAGCCAGACTATGGTCAACAAGATTCATATGA CCAGCAGTCAGGCTATGATCAACATCAAGGCTCATATGATGAGCAGTCAAATTATGATCAGCAGCATGAT TCCTATAGTCAAAACCAGCAGTCCTATCATTCACAAAGGGAAAACTACAGCCACCACACACAAGATGACC GTCGTGATGTGAGTAGGTATGGAGAAGATAATAGAGGATATGGCGGGTCACAGGGAGGAGGTAGAGGGCG TGGGGGATATGACAAGGATGGAAGAGGTCCTATGACAGGATCAAGTGGTGGTGACCGCGGTGGCTTCAAA AATTTTGGTGGTCACAGGGATTATGGACCCAGAACAGATGCTGATTCAGAATCTGATAATTCAGATAACA ACACAATCTTTGTGCAAGGACTTGGGGAGGGTGTGTCTACAGATCAAGTTGGGGAGTTCTTTAAACAAAT AGGAATTATCAAGACAAATAAGAAGACCGGAAAACCAATGATAAATCTTTATACAGACAAGGACACAGGA AAGCCAAAGGGGGAGGCAACAGTGTCATTTGATGACCCTCCTTCAGCTAAGGCAGCCATTGACTGGTTTG ATGGAAAAGAATTCCATGGCAACATCATTAAAGTGTCCTTTGCCACTAGAAGACCTGAATTCATGAGAGG AGGTGGAAGTGGAGGTGGGCGGCGAGGCCGTGGAGGATATAGAGGTCGTGGAGGCTTTCAAGGGAGAGGT GGAGACCCCAAAAGTGGGGATTGGGTTTGCCCTAATCCGTCATGCGGAAATATGAACTTTGCTCGAAGGA ATTCCTGCAATCAGTGCAATGAGCCTAGACCAGAGGACTCTCGTCCCTCAGGAGGAGATTTCCGGGGGAG AGGCTACGGTGGAGAGAGGGGCTACAGAGGTCGTGGGGGCAGAGGTGGAGACCGAGGCGGCTATGGTGGA GACAGAAGTGGGGGTGGCTATGGTGGAGACAGAAGCAGCGGTGGTGGCTACAGCGGAGATAGAAGTGGGG GCGGCTATGGTGGAGACAGAAGTGGGGGTGGCTATGGTGGGGACAGAGGCGGCGGCTATGGTGGGGACAG AGGAGGCGGCTATGGAGGAGACCGAGGAGGTGGCTATGGAGGAGATCGAGGTGGCTATGGAGGAGACCGA GGTGGAGGCTATGGTGGAGACCGAGGAGGCTATGGAGGAGATCGAGGAGGTTACGGAGGAGATCGAGGAG GTTATGGAGGAGATCGAGGAGGCTATGGAGGAGACAGAAGCCGGGGGGGCTATGGAGGAGACCGTGGTGG TGGCAGTGGCTACGGTGGAGACCGAAGTGGAGGCTATGGAGGAGACAGGAGTGGTGGCGGCTATGGAGGA GACCGAGGTGGGGGCTACGGAGGAGACCGAGGTGGCTATGGAGGCAAAATGGGAGGAAGAAACGACTACA GAAATGATCAGCGCAACCGACCATACTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_139215 |
Insert Size | 2200 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_139215.1. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_139215.1, NP_631961.1 |
RefSeq Size | 2153 bp |
RefSeq ORF | 1779 bp |
Locus ID | 8148 |
UniProt ID | Q92804 |
Cytogenetics | 17q12 |
Protein Families | Druggable Genome |
Summary | This gene encodes a member of the TET family of RNA-binding proteins. The encoded protein plays a role in RNA polymerase II gene transcription as a component of a distinct subset of multi-subunit transcription initiation factor TFIID complexes. Translocations involving this gene play a role in acute leukemia and extraskeletal myxoid chondrosarcoma, and mutations in this gene may play a role in amyotrophic lateral sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC208489 | TAF15 (Myc-DDK-tagged)-Human TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa (TAF15), transcript variant 1 | 10 ug |
$826.00
|
|
RC208489L1 | Lenti ORF clone of Human TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa (TAF15), transcript variant 1, Myc-DDK-tagged | 10 ug |
$1,126.00
|
|
RC208489L2 | Lenti ORF clone of Human TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa (TAF15), transcript variant 1, mGFP tagged | 10 ug |
$1,126.00
|
|
RC208489L3 | Lenti ORF clone of Human TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa (TAF15), transcript variant 1, Myc-DDK-tagged | 10 ug |
$1,126.00
|
|
RC208489L4 | Lenti ORF clone of Human TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa (TAF15), transcript variant 1, mGFP tagged | 10 ug |
$1,126.00
|
|
RG208489 | TAF15 (tGFP-tagged) - Human TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa (TAF15), transcript variant 1 | 10 ug |
$1,026.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.