NETO1 (NM_138999) Human Untagged Clone

SKU
SC306098
NETO1 (untagged)-Human neuropilin (NRP) and tolloid (TLL)-like 1 (NETO1), transcript variant 1
$165.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NETO1
Synonyms BCTL1; BTCL1
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_138999, the custom clone sequence may differ by one or more nucleotides
ATGCTGGCAGAGCCATTCCCTAAGGTTGTAGCAAGTTTAATCATCCTCCATTTGTCTGGG
GCAACCAAGAAAGGAACAGAAAAGCAAACCACCTCAGAAACACAGAAGTCAGTGCAGTGT
GGAACTTGGACAAAACATGCAGAGGGAGGTATCTTTACCTCTCCCAACTATCCCAGCAAG
TATCCCCCTGACCGGGAATGCATCTACATCATAGAAGCCGCTCCAAGACAGTGCATTGAA
CTTTACTTTGATGAAAAGTACTCTATTGAACCGTCTTGGGAGTGCAAATTTGATCATATT
GAAGTTCGAGATGGACCTTTTGGCTTTTCTCCAATAATTGGACGTTTCTGTGGACAACAA
AATCCACCTGTCATAAAATCCAGTGGAAGATTTCTATGGATTAAATTTTTTGCTGATGGA
GAGCTGGAATCTATGGGATTTTCAGCTCGATACAATTTCACACCTGAATAA
Restriction Sites Please inquire
ACCN NM_138999
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_138999.1, NP_620552.1
RefSeq Size 1849 bp
RefSeq ORF 471 bp
Locus ID 81832
UniProt ID Q8TDF5
Cytogenetics 18q22.3
Protein Families Druggable Genome, Transmembrane
Summary This gene encodes a transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. This protein is thought to play a critical role in spatial learning and memory by regulating the function of synaptic N-methyl-D-aspartic acid receptor complexes in the hippocampus. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2017]
Transcript Variant: This variant (1), also known as sNETO1, encodes isoform 1 and was described by Stohr et. al (PMID:11943477).
Write Your Own Review
You're reviewing:NETO1 (NM_138999) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217464 NETO1 (Myc-DDK-tagged)-Human neuropilin (NRP) and tolloid (TLL)-like 1 (NETO1), transcript variant 1 10 ug
$225.00
RC217464L3 Lenti-ORF clone of NETO1 (Myc-DDK-tagged)-Human neuropilin (NRP) and tolloid (TLL)-like 1 (NETO1), transcript variant 1 10 ug
$525.00
RC217464L4 Lenti-ORF clone of NETO1 (mGFP-tagged)-Human neuropilin (NRP) and tolloid (TLL)-like 1 (NETO1), transcript variant 1 10 ug
$525.00
RG217464 NETO1 (tGFP-tagged) - Human neuropilin (NRP) and tolloid (TLL)-like 1 (NETO1), transcript variant 1 10 ug
$425.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.