KLF14 (NM_138693) Human Untagged Clone

SKU
SC306059
KLF14 (untagged)-Human Kruppel-like factor 14 (KLF14)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KLF14
Synonyms BTEB5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_138693 edited
GTCAAGGCCCACCATGTCGGCCGCCGTGGCGTGCCTGGACTACTTCGCCGCCGAGTGCCT
GGTGTCCATGTCCGCGGGCGCCGTGGTTCACCGCCGCCCGCCGGACCCCGAGGGCGCGGG
TGGAGCCGCAGGCTCGGAGGTGGGTGCGGCGCATCCGGAGTCCGCTCTGCCGGGTCCGGG
GCCATCGGGGCCCGCGTCGGTCCCCCAGCTCCCGCAGGTCCCCGCCCCCAGCCCCGGCGC
GGGCGGCGCCGCGCCCCACCTGCTGGCTGCAAGCGTCTGGGCGGACTTGCGCGGCAGCTC
TGGCGAGGGCTCCTGGGAGAACTCGGGGGAAGCTCCACGCGCCTCGTCCGGCTTCTCCGA
CCCGATCCCGTGCTCCGTCCAGACCCCGTGCTCCGAGCTGGCTCCCGCCTCCGGCGCCGC
GGCGGTCTGCGCTCCCGAGAGCTCCTCCGATGCGCCCGCCGTCCCAAGCGCGCCTGCTGC
CCCGGGCGCACCAGCAGCCTCTGGTGGGTTCTCTGGAGGGGCCCTAGGGGCAGGCCCCGC
CCCCGCCGCGGATCAGGCGCCCCGGAGGAGGTCTGTCACACCTGCTGCCAAGCGCCACCA
ATGCCCCTTCCCGGGCTGCACCAAAGCCTATTACAAGTCGTCGCACCTCAAGTCCCACCA
GCGCACCCACACGGGTGAGCGCCCTTTCTCCTGCGACTGGCTCGACTGCGACAAGAAGTT
TACGCGTTCCGACGAGCTGGCCCGCCACTACAGGACGCACACGGGCGAGAAGCGCTTCTC
CTGCCCCCTCTGCCCCAAGCAGTTCTCCCGGAGCGACCACCTGACCAAGCATGCTCGCCG
CCACCCAACCTATCATCCAGATATGATCGAGTACCGGGGACGTCGTCGAACTCCCCGCAT
CGACCCGCCACTCACCAGCGAGGTGGAAAGCTCCGCCTCCGGCTCCGGTCCCGGCCCGGC
GCCCAGCTTCACCACCTGCCTGTAGG
Restriction Sites Please inquire
ACCN NM_138693
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_138693.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_138693.1, NP_619638.1
RefSeq Size 1383 bp
RefSeq ORF 972 bp
Locus ID 136259
UniProt ID Q8TD94
Cytogenetics 7q32.2
Summary This intronless gene encodes a member of the Kruppel-like family of transcription factors. The encoded protein functions as a transcriptional co-repressor, and is induced by transforming growth factor-beta (TGF-beta) to repress TGF-beta receptor II gene expression. This gene exhibits imprinted expression from the maternal allele in embryonic and extra-embryonic tissues. [provided by RefSeq, Jul 2013]
Write Your Own Review
You're reviewing:KLF14 (NM_138693) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213087 KLF14 (Myc-DDK-tagged)-Human Kruppel-like factor 14 (KLF14) 10 ug
$300.00
RC213087L1 Lenti ORF clone of Human Kruppel-like factor 14 (KLF14), Myc-DDK-tagged 10 ug
$600.00
RC213087L2 Lenti ORF clone of Human Kruppel-like factor 14 (KLF14), mGFP tagged 10 ug
$600.00
RC213087L3 Lenti ORF clone of Human Kruppel-like factor 14 (KLF14), Myc-DDK-tagged 10 ug
$600.00
RC213087L4 Lenti ORF clone of Human Kruppel-like factor 14 (KLF14), mGFP tagged 10 ug
$600.00
RG213087 KLF14 (tGFP-tagged) - Human Kruppel-like factor 14 (KLF14) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.