PTCRA (NM_138296) Human Untagged Clone

SKU
SC306002
PTCRA (untagged)-Human pre T-cell antigen receptor alpha (PTCRA)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PTCRA
Synonyms PT-ALPHA; PTA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_138296 edited
TCCTGCCTCCTTCCGAGTGGGCCATGGCCGGTACATGGCTGCTACTTCTCCTGGCCCTTG
GGTGTCCAGCCCTACCCACAGGTGTGGGCGGCACACCCTTTCCTTCTCTGGCCCCACCAA
TCATGCTGCTGGTGGATGGAAAGCAGCAGATGGTGGTGGTCTGCCTGGTCCTTGATGTTG
CACCCCCTGGCCTTGACAGCCCCATCTGGTTCTCAGCCGGCAATGGCAGTGCACTGGATG
CCTTCACCTATGGCCCTTCCCCAGCAACGGATGGCACCTGGACCAACTTGGCCCATCTCT
CCCTGCCTTCTGAGGAGCTGGCATCCTGGGAGCCTTTGGTCTGCCACACTGGGCCTGGGG
CTGAGGGTCACAGCAGGAGTACACAGCCCATGCATCTGTCAGGAGAGGCTTCTACAGCCA
GGACCTGCCCCCAGGAGCCTCTCAGGGGGACACCGGGTGGGGCGCTGTGGCTGGGGGTCC
TGCGGCTGCTGCTCTTCAAGCTGCTGCTGTTTGACCTGCTCCTGACCTGCAGCTGCCTGT
GCGACCCCGCGGGCCCGCTGCCTTCCCCCGCAACCACCACCCGCCTGCGAGCCCTCGGCT
CCCATCGACTGCACCCGGCCACGGAGACTGGGGGACGAGAGGCCACCAGCTCACCCAGAC
CCCAGCCTCGGGACCGCCGCTGGGGTGACACCCCTCCGGGTCGGAAGCCCGGGAGCCCAG
TATGGGGGGAAGGGTCTTACCTCAGCAGTTACCCCACTTGCCCAGCACAGGCCTGGTGCT
CAAGATCTGCCCTCAGGGCTCCTTCCTCCAGTCTTGGAGCATTTTTTGCAGGTGACCTGC
CTCCTCCTCTGCAGGCTGGAGCTGCCTGAGGGCAGGGCTCTACCTCCCCTGCGTCACACT
GTGTGAGGCTGTGTCTCTGCCATCCAAAAGGGGGCCCCTTGAGAATGGTGATCCACCCAG
TTACAGGGGCATTTAGGGAGCAGATGACTGAG
Restriction Sites Please inquire
ACCN NM_138296
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_138296.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_138296.1, NP_612153.1
RefSeq Size 1080 bp
RefSeq ORF 846 bp
Locus ID 171558
UniProt ID Q6ISU1
Cytogenetics 6p21.1
Protein Families Transmembrane
Protein Pathways Notch signaling pathway
Summary The protein encoded by this gene is a single-pass type I membrane protein that is found in immmature but not mature T-cells. Along with TCRB and CD3 complex, the encoded protein forms the pre-T-cell receptor complex, which regulates early T-cell development. Four transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (2) lacks an alternate internal segment compared to isoform 1.
Write Your Own Review
You're reviewing:PTCRA (NM_138296) Human Untagged Clone
Your Rating
SKU Description Size Price
RC215794 PTCRA (Myc-DDK-tagged)-Human pre T-cell antigen receptor alpha (PTCRA) 10 ug
$300.00
RC215794L1 Lenti-ORF clone of PTCRA (Myc-DDK-tagged)-Human pre T-cell antigen receptor alpha (PTCRA) 10 ug
$600.00
RC215794L2 Lenti-ORF clone of PTCRA (mGFP-tagged)-Human pre T-cell antigen receptor alpha (PTCRA) 10 ug
$600.00
RC215794L3 Lenti-ORF clone of PTCRA (Myc-DDK-tagged)-Human pre T-cell antigen receptor alpha (PTCRA) 10 ug
$600.00
RC215794L4 Lenti-ORF clone of PTCRA (mGFP-tagged)-Human pre T-cell antigen receptor alpha (PTCRA) 10 ug
$600.00
RG215794 PTCRA (tGFP-tagged) - Human pre T-cell antigen receptor alpha (PTCRA) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.