WNT8A (NM_058244) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | WNT8A |
Synonyms | WNT8D |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF sequence for NM_058244 edited
ATGGGGAACCTGTTTATGCTCTGGGCAGCTCTGGGCATATGCTGTGCTGCATTCAGTGCC TCTGCCTGGTCAGTGAACAATTTCCTGATAACAGGTCCCAAGGCCTATCTGACCTACACG ACTAGTGTGGCCTTGGGTGCCCAGAGTGGCATCGAGGAGTGCAAGTTCCAGTTTGCTTGG GAACGCTGGAACTGCCCTGAAAATGCTCTTCAGCTCTCCACCCACAACAGGCTGAGAAGT GCTACCAGAGAGACTTCCTTCATACATGCTATCAGCTCTGCTGGAGTCATGTACATCATC ACCAAGAACTGTAGCATGGGTGACTTCGAAAACTGTGGCTGTGATGGGTCAAACAATGGA AAAACAGGAGGCCATGGCTGGATCTGGGGAGGCTGCAGCGACAATGTGGAATTTGGGGAA AGGATCTCCAAACTCTTTGTGGACAGTTTGGAGAAGGGGAAGGATGCCAGAGCCCTGATG AATCTTCACAACAACAGGGCCGGCAGACTGGCAGTGAGAGCCACCATGAAAAGGACATGC AAATGTCATGGCATCTCTGGGAGCTGCAGCATACAGACATGCTGGCTGCAGCTGGCTGAA TTCCGGGAGATGGGAGACTACCTAAAGGCCAAGTATGACCAGGCGCTGAAAATTGAAATG GATAAGCGGCAGCTGAGAGCTGGGAACAGCGCCGAGGGCCACTGGGTGCCCGCTGAGGCC TTCCTTCCTAGCGCAGAGGCGGAACTGATCTTTTTAGAGGAATCACCAGATTACTGTACC TGCAATTCCAGCCTGGGCATCTATGGCACAGAGGGTCGTGAGTGCCTACAGAACAGCCAC AACACATCCAGGTGGGAGCGACGTAGCTGTGGGCGCCTGTGCACTGAGTGTGGGCTGCAG GTGGAAGAGAGGAAAACTGAGGTCATAAGCAGCTGTAACTGCAAATTCCAGTGGTGCTGT ACGGTCAAGTGTGACCAGTGTAGGCATGTGGTGAGCAAGTATTACTGCGCACGCTCCCCA GGCAGTGCCCAGTCCCTGGGTAAGGGCAGTGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_058244 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_058244.1. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_058244.1, NP_490645.1 |
RefSeq Size | 1899 bp |
RefSeq ORF | 1056 bp |
Locus ID | 7478 |
UniProt ID | Q9H1J5 |
Cytogenetics | 5q31.2 |
Protein Families | Cancer stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Secreted Protein, Stem cell relevant signaling - Wnt Signaling pathway |
Protein Pathways | Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway |
Summary | The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family, and may be implicated in development of early embryos as well as germ cell tumors. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (3) lacks an internal segment in the 5' region and has an additional segment in the 3' region, which result in alternate translation start codon and stop codon respectively, compared to variant 1. The resulting isoform (3) is shorter and has distinct N- and C-termini, compared to isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC224816 | WNT8A (Myc-DDK-tagged)-Human wingless-type MMTV integration site family, member 8A (WNT8A) | 10 ug |
$457.00
|
|
RC224816L1 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 8A (WNT8A), Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC224816L2 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 8A (WNT8A), mGFP tagged | 10 ug |
$757.00
|
|
RC224816L3 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 8A (WNT8A), Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC224816L4 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 8A (WNT8A), mGFP tagged | 10 ug |
$757.00
|
|
RG224816 | WNT8A (tGFP-tagged) - Human wingless-type MMTV integration site family, member 8A (WNT8A) | 10 ug |
$489.00
MSRP
$657.00
MSRP
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.