CGB2 (NM_033378) Human Untagged Clone

SKU
SC305621
CGB2 (untagged)-Human chorionic gonadotropin, beta polypeptide 2 (CGB2)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CGB2
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_033378, the custom clone sequence may differ by one or more nucleotides
ATGTCAAAGGGGCTGCTGCTGTTGCTGCTGCTGAGCATGGGCGGGACATGGGCATCCAAG
GAGCCGCTTCGGCCACGGTGCCGCCCCATCAATGCCACCCTGGCTGTGGAGAAGGAGGGC
TGCCCCGTGTGCATCACCGTCAACACCACCATCTGTGCCGGCTACTGCCCCACCATGACC
CGCGTGCTGCAGGGGGTCCTGCCGGCCCTGCCTCAGGTGGTGTGCAACTACCGCGATGTG
CGCTTCGAGTCCATCCGGCTCCCTGGCTGCCCGCGCGGCGTGAACCCCGTGGTCTCCTAC
GCCGTGGCTCTCAGCTGTCAATGTGCACTCTGCCGCCGCAGCACCACTGACTGCGGGGGT
CCCAAGGACCACCCCTTGACCTGTGATGACCCCCGCTTCCAGGCCTCCTCTTCCTCAAAG
GCCCCTCCCCCCAGCCTTCCAAGCCCATCCCGACTCCCGGGGCCCTCAGACACCCCGATC
CTCCCACAATAA
Restriction Sites Please inquire
ACCN NM_033378
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_033378.1, NP_203696.2
RefSeq Size 732 bp
RefSeq ORF 492 bp
Locus ID 114336
UniProt ID Q6NT52
Cytogenetics 19q13.33
Protein Families Druggable Genome
Summary The beta subunit of chorionic gonadotropin (CGB) is encoded by six highly homologous and structurally similar genes that are arranged in tandem and inverted pairs on chromosome 19q13.3, and contiguous with the luteinizing hormone beta (LHB) subunit gene. The CGB genes are primarily distinguished by differences in the 5' untranscribed region. This gene was originally thought to be one of the two pseudogenes (CGB1 and CGB2) of CGB subunit, however, detection of CGB1 and CGB2 transcripts in vivo, and their presence on the polysomes, suggested that these transcripts are translated. To date, a protein product corresponding to CGB2 has not been isolated. The deduced sequence of the hypothetical protein of 132 aa does not share any similarity with that of functional CGB subunits (PMID:8954017). However, a 163 aa protein, translated from a different frame, is about the same size, and shares 98% identity with other CGB subunits. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (1).
Write Your Own Review
You're reviewing:CGB2 (NM_033378) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221679 CGB2 (Myc-DDK-tagged)-Human chorionic gonadotropin, beta polypeptide 2 (CGB2) 10 ug
$289.00
RC221679L3 Lenti-ORF clone of CGB2 (Myc-DDK-tagged)-Human chorionic gonadotropin, beta polypeptide 2 (CGB2) 10 ug
$450.00
RC221679L4 Lenti-ORF clone of CGB2 (mGFP-tagged)-Human chorionic gonadotropin, beta polypeptide 2 (CGB2) 10 ug
$450.00
RG221679 CGB2 (tGFP-tagged) - Human chorionic gonadotropin, beta polypeptide 2 (CGB2) 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.