RNF39 (NM_025236) Human Untagged Clone

SKU
SC305248
RNF39 (untagged)-Human ring finger protein 39 (RNF39), transcript variant 1
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RNF39
Synonyms FAP216; HZF; HZFW; LIRF
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_025236 edited
GTACAAAAAAGCAGAAGGGCCGTCAAGGCCCACCATGTGGTGGAGAGATTTGACGAGACT
GAGACTCTGGTTGAAGAGAGAGGCAATCCCAGGAGAGGGGCGGAAAGCGGCAAAAGTTAA
TGCGGGAGTCGGAGAGAAGGGCATCTACACAGCAAGCAGCAGGGGCGGCCCGCCATCTGC
GCGCTCGAAGGCGGTCACGGTGGTCGCGGAAGGGGCGGCGTCCAGATCCTGGCTTTCCAT
GGATGCGCCCGAGCTGGGCCCGGGGCTGGTGGAGCGTCTGGAGCAGCTGGCGACGTGTCC
TCTGTGCGGGGGCTCCTTCGAGGACCCGGTGCTTCTGGCGTGCGAGCACAGCTTCTGCCG
CGCGTGTCTGGCCCGCCGCTGGGGGACTCCGCCGGCGACCGGCACCGAGGCTTCCCCCAC
CGCCTGTCCCTGCTGCGGCCTGCCGTGTCCCCGCCGCAGCCTGAGGTCTAATGTGCGGCT
GGCGGTGGAGGTGCGAATCAGCCGCGAGCTGCGAGAGAAGCTGGCTGAGCCTGGGGCCCG
TGCGGGGAGACGCCGAGGGGGGCGCATCCCCACCATGGGCTGCCTGGACCTGCCCGGAGA
GGATATGAGGAAGACATGGAGACGATTTGAAGTCCCAACATCCAAGTCATCTAATTCAGA
GGATGATCTCCCTGAAGATTATCCAGTGGTCAAAAAAATGCTTCATAGACTGACAGCCGA
CCTGACCCTGGACCCTGGGACCGCACACCGCCGCCTGCTCATCTCCGCCGACCGCCGCAG
CGTACAACTGGCCCCACCAGGGACGCCCGCGCCCCCTGACGGCCCCAAGCGCTTCGATCA
GCTCCCAGCTGTGCTGGGTGCGCAGGGCTTCGGGGCCGGCCGCCACTGCTGGGAGGTGGA
GACTGCGGACGCCGCCTCCTGCAGAGACTCTTCTGGGGAGGATGCGGACGACGAGGAGAG
CCACTATGCAGTGGGCGCGGCCGGGGAATCAGTGCAACGCAAGGGCTGCGTAAGGCTGTG
CCCTGCGGGGGCCGTGTGGGCCGTGGAGGGCCGCGGCGGCCGCCTGTGGGCCCTCACGGC
ACCCGAACCCACCCTGCTGGGCGGTGTTGAGCCCCCGCCGCGGCGCATTCGCGTGGACCT
GGACTGGGAGCGGGGCCGCGTGGCCTTCTACGACGGCCGCTCACTCGACCTGCTTTACGC
CTTCCAGGCGCCTGGCCCCCTGGGGGAGCGCATCTTCCCGCTGTTCTGCACCTGCGACCC
TCGTGCTCCGCTCCGCATTGTACCAGCGGAAAGCTGAGGCCTCATGGGCCCAGCTTTCTT
GTAC
Restriction Sites Please inquire
ACCN NM_025236
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_025236.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_025236.2, NP_079512.1
RefSeq Size 2187 bp
RefSeq ORF 1263 bp
Locus ID 80352
UniProt ID Q9H2S5
Cytogenetics 6p22.1
Protein Families Druggable Genome
Summary This gene lies within the major histocompatibility complex class I region on chromosome 6. Studies of a similar rat protein suggest that this gene encodes a protein that plays a role in an early phase of synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1), also known as HZFw1, represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:RNF39 (NM_025236) Human Untagged Clone
Your Rating
SKU Description Size Price
RC219332 RNF39 (Myc-DDK-tagged)-Human ring finger protein 39 (RNF39), transcript variant 1 10 ug
$457.00
RC219332L1 Lenti ORF clone of Human ring finger protein 39 (RNF39), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC219332L2 Lenti ORF clone of Human ring finger protein 39 (RNF39), transcript variant 1, mGFP tagged 10 ug
$757.00
RC219332L3 Lenti ORF clone of Human ring finger protein 39 (RNF39), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC219332L4 Lenti ORF clone of Human ring finger protein 39 (RNF39), transcript variant 1, mGFP tagged 10 ug
$757.00
RG219332 RNF39 (tGFP-tagged) - Human ring finger protein 39 (RNF39), transcript variant 1 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.