Wilms Tumor Protein (WT1) (NM_024424) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Wilms Tumor Protein |
Synonyms | AWT1; GUD; NPHS4; WAGR; WIT-2; WT33 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_024424 edited
AGATCTGCCATGCAGGACCCGGCTTCCACGTGTGTCCCGGAGCCGGCGTCTCAGCACACG CTCCGCTCCGGGCCTGGGTGCCTACAGCAGCCAGAGCAGCAGGGAGTCCGGGACCCGGGC GGCATCTGGGCCAAGTTAGGCGCCGCCGAGGCCAGCGCTGAACGTCTCCAGGGCCGGAGG AGCCGCGGGGCGTCCGGGTCTGAGCCGCAGCAAATGGGCTCCGACGTGCGGGACCTGAAC GCGCTGCTGCCCGCCGTCCCCTCCCTGGGTGGCGGCGGCGGCTGTGCCCTGCCTGTGAGC GGCGCGGCGCAGTGGGCGCCGGTGCTGGACTTTGCGCCTCCGGGCGCTTCGGCTTACGGG TCGTTGGGCGGCCCCGCGCCGCCACCGGCTCCGCCGCCACCCCCGCCGCCGCCGCCTCAC TCCTTCATCAAACAGGAGCCGAGCTGGGGCGGCGCGGAGCCGCACGAGGAGCAGTGCCTG AGCGCCTTCACTGTCCACTTTTCCGGCCAGTTCACTGGCACAGCCGGAGCCTGTCGCTAC GGGCCCTTCGGTCCTCCTCCGCCCAGCCAGGCGTCATCCGGCCAGGCCAGGATGTTTCCT AACGCGCCCTACCTGCCCAGCTGCCTCGAGAGCCAGCCCGCTATTCGCAATCAGGGTTAC AGCACGGTCACCTTCGACGGGACGCCCAGCTACGGTCACACGCCCTCGCACCATGCGGCG CAGTTCCCCAACCACTCATTCAAGCATGAGGATCCCATGGGCCAGCAGGGCTCGCTGGGT GAGCAGCAGTACTCGGTGCCGCCCCCGGTCTATGGCTGCCACACCCCCACCGACAGCTGC ACCGGCAGCCAGGCTTTGCTGCTGAGGACGCCCTACAGCAGTGACAATTTATACCAAATG ACATCCCAGCTTGAATGCATGACCTGGAATCAGATGAACTTAGGAGCCACCTTAAAGGGA GTTGCTGCTGGGAGCTCCAGCTCAGTGAAATGGACAGAAGGGCAGAGCAACCACAGCACA GGGTACGAGAGCGATAACCACACAACGCCCATCCTCTGCGGAGCCCAATACAGAATGCAC ACGCACGGTGTCTTCAGAGGCATTCGGGATGTGCGGCGTGTGCCTGGAGTAGCCCCGACT CTTGTACGGTCGGCATCTGAGACCAGTGAGAAACGCCCCTTCATGTGTGCTTACCCAGGC TGCAATAAGAGATATTTTAAGCTGTCCCACTTACAGATGCACAGCAGGAAGCACACTGGT GAGAAACCATACCAGTGTGACTTCAAGGACTGTGAACGAAGGTTTTCTCGTTCAGACCAG CTCAAAAGACACCAAAGGAGACATACAGGTGTGAAACCATTCCAGTGTAAAACTTGTCAG CGAAAGTTCTCCCGGTCCGACCACCTGAAGACCCACACCAGGACTCATACAGGTGAAAAG CCCTTCAGCTGTCGGTGGCCAAGTTGTCAGAAAAAGTTTGCCCGGTCAGATGAATTAGTC CGCCATCACAACATGCATCAGAGAAACATGACCAAACTCCAGCTGGCGCTTTGATCTAGA |
Restriction Sites | Please inquire |
ACCN | NM_024424 |
Insert Size | 1600 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. There are four SNPs within ORF, and one SNP alters amino acid. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_024424.2, NP_077742.2 |
RefSeq Size | 3020 bp |
RefSeq ORF | 1545 bp |
Locus ID | 7490 |
UniProt ID | P19544 |
Cytogenetics | 11p13 |
Protein Families | Druggable Genome, Transcription Factors |
Summary | This gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It has an essential role in the normal development of the urogenital system, and it is mutated in a small subset of patients with Wilms tumor. This gene exhibits complex tissue-specific and polymorphic imprinting pattern, with biallelic, and monoallelic expression from the maternal and paternal alleles in different tissues. Multiple transcript variants have been described. In several variants, there is evidence for the use of a non-AUG (CUG) translation initiation codon upstream of, and in-frame with the first AUG. Authors of PMID:7926762 also provide evidence that WT1 mRNA undergoes RNA editing in human and rat, and that this process is tissue-restricted and developmentally regulated. [provided by RefSeq, Mar 2015] Transcript Variant: This variant (B) uses an alternate, in-frame splice site in the 3' coding region, compared to variant D. This results in a shorter protein (isoform B), compared to isoform D. It initiates translation from a non-AUG (CUG) site, and also from a downstream, in-frame AUG. CCDS Note: The coding region has been updated to start at a non-AUG translation start codon that is supported by a publication and protein conservation. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC221271 | WT1 (Myc-DDK-tagged)-Human Wilms tumor 1 (WT1), transcript variant B | 10 ug |
$718.00
|
|
RC221271L1 | Lenti ORF clone of Human Wilms tumor 1 (WT1), transcript variant B, Myc-DDK-tagged | 10 ug |
$1,018.00
|
|
RC221271L2 | Lenti ORF clone of Human Wilms tumor 1 (WT1), transcript variant B, mGFP tagged | 10 ug |
$1,018.00
|
|
RC221271L3 | Lenti ORF clone of Human Wilms tumor 1 (WT1), transcript variant B, Myc-DDK-tagged | 10 ug |
$1,018.00
|
|
RC221271L4 | Lenti ORF clone of Human Wilms tumor 1 (WT1), transcript variant B, mGFP tagged | 10 ug |
$1,018.00
|
|
RG221271 | WT1 (tGFP-tagged) - Human Wilms tumor 1 (WT1), transcript variant B | 10 ug |
$918.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.