HAND2 (NM_021973) Human Untagged Clone

SKU SC304979

HAND2 (untagged)-Human heart and neural crest derivatives expressed 2 (HAND2)

Product Data

• Type: Human Untagged Clone
• Target Symbol: HAND2
• Synonyms: bHLHa26; dHand; DHAND2; Hed; Thing2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_021973 edited; GCGAAATGAGTCTGGTAGGTGGTTTTCCCCACCACCCGGTGGTGCACCACGAGGGCTACC; CGTTTGCCGCCGCCGCCGCCGCAGCTGCCGCCGCCGCCGCCAGCCGCTGCAGCCATGAGG; AGAACCCCTACTTCCATGGCTGGCTCATCGGCCACCCCGAGATGTCGCCCCCCGACTACA; GCATGGCCCTGTCCTACAGCCCCGAGTATGCCAGCGGCGCCGCCGGCCTGGACCACTCCC; ATTACGGGGGGGTGCCGCCGGGCGCCGGGCCCCCGGGCCTGGGGGGGCCGCGCCCGGTGA; AGCGCCGAGGCACCGCCAACCGCAAGGAGCGGCGCAGGACTCAGAGCATCAACAGCGCCT; TCGCCGAACTGCGCGAGTGCATCCCCAACGTACCCGCCGACACCAAACTCTCCAAAATCA; AGACCCTGCGCCTGGCCACCAGCTACATCGCCTACCTCATGGACCTGCTGGCCAAGGACG; ACCAGAATGGCGAGGCGGAGGCCTTCAAGGCAGAGATCAAGAAGACCGACGTGAAAGAGG; AGAAGAGGAAGAAGGAGCTGAACGAAATCTTGAAAAGCACAGTGAGCAGCAACGACAAGA; AAACCAAAGGCCGGACGGGCTGGCCGCAGCACGTCTGGGCCCTGGAGCTCAAGCAGTGAG; GAGGAGGAGAAGGAGGAGGAGGAGAGCGCGAGTGAGCAGGGGCCAAGGCGCCAGATGCAG; ACCCAGGACTCCGGAAAAGCCGTC;
• Restriction Sites: Please inquire
• ACCN: NM_021973
• Insert Size: 800 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.; ; The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: ORF matches with reference.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_021973.1, NP_068808.1
• RefSeq Size: 1234 bp
• RefSeq ORF: 654 bp
• Locus ID: 9464
• UniProt ID: P61296
• Cytogenetics: 4q34.1
• Protein Families: Druggable Genome
• Summary: The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, this transcription factor plays an important role in limb and branchial arch development. [provided by RefSeq, Jul 2008]