H2AC8 (NM_021052) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | H2AC8 |
Synonyms | H2A.1; H2A.2; H2A/a; H2AC4; H2AFA; HIST1H2AE |
Vector | pCMV6 series |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_021052, the custom clone sequence may differ by one or more nucleotides
ATGTCTGGACGTGGAAAGCAAGGCGGCAAAGCTCGGGCAAAAGCTAAAACGCGTTCTTCC AGGGCCGGTCTTCAGTTTCCAGTTGGCCGTGTGCACCGCCTCCTCCGCAAAGGCAACTAC TCCGAACGAGTCGGGGCCGGCGCTCCAGTGTACCTGGCAGCGGTGCTGGAATATCTGACG GCCGAGATCTTAGAGCTAGCTGGCAACGCGGCTCGCGACAATAAGAAGACCCGCATCATC CCGCGCCACCTGCAGCTAGCCATCCGCAACGACGAGGAGCTAAATAAGCTTCTAGGTCGC GTGACCATCGCGCAGGGCGGTGTCCTGCCCAACATCCAGGCCGTATTGCTGCCTAAGAAG ACGGAGAGCCACCATAAGGCCAAGGGCAAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_021052 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_021052.2, NP_066390.1 |
RefSeq Size | 564 bp |
RefSeq ORF | 393 bp |
Locus ID | 3012 |
UniProt ID | P04908 |
Cytogenetics | 6p22.2 |
Protein Pathways | Systemic lupus erythematosus |
Summary | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC210850 | HIST1H2AE (Myc-DDK-tagged)-Human histone cluster 1, H2ae (HIST1H2AE) | 10 ug |
$150.00
|
|
RC210850L3 | Lenti-ORF clone of HIST1H2AE (Myc-DDK-tagged)-Human histone cluster 1, H2ae (HIST1H2AE) | 10 ug |
$450.00
|
|
RC210850L4 | Lenti-ORF clone of HIST1H2AE (mGFP-tagged)-Human histone cluster 1, H2ae (HIST1H2AE) | 10 ug |
$450.00
|
|
RG210850 | HIST1H2AE (tGFP-tagged) - Human histone cluster 1, H2ae (HIST1H2AE) | 10 ug |
$350.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.