SALL4 (NM_020436) Human Untagged Clone

CAT#: SC304767

Reviews ()
Write a review

SALL4 (untagged)-Human sal-like 4 (Drosophila) (SALL4)



Reconstitution Protocol

USD 1,376.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SALL4
Synonyms DRRS; HSAL4; IVIC; ZNF797
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_020436 edited
CACCTGGCGGAGAGGGCAAATAACTGCGGCTCTCCCGGCGCCCCGATGCTCGCACCATGT
CGAGGCGCAAGCAGGCGAAACCCCAGCACATCAACTCGGAGGAGGACCAGGGCGAGCAGC
AGCCGCAGCAGCAGACCCCGGAGTTTGCAGATGCGGCCCCAGCGGCGCCCGCGGCGGGGG
AGCTGGGTGCTCCAGTGAACCACCCAGGGAATGACGAGGTGGCGAGTGAGGATGAAGCCA
CAGTAAAGCGGCTTCGTCGGGAGGAGACGCACGTCTGTGAGAAATGCTGTGCGGAGTTCT
TCAGCATCTCTGAGTTCCTGGAACATAAGAAAAATTGCACTAAAAATCCACCTGTCCTCA
TCATGAATGACAGCGAGGGGCCTGTGCCTTCAGAAGACTTCTCCGGAGCTGTACTGAGCC
ACCAGCCCACCAGTCCCGGCAGTAAGGACTGTCACAGGGAGAATGGCGGCAGCTCAGAGG
ACATGAAGGAGAAGCCGGATGCGGAGTCTGTGGTGTACCTAAAGACAGAGACAGCCCTGC
CACCCACCCCCCAGGACATAAGCTATTTAGCCAAAGGCAAAGTGGCCAACACTAACGTGA
CCTTGCAGGCACTACGGGGCACCAAGGTGGCGGTGAATCAGCGGAGCGCGGATGCACTCC
CTGCCCCCGTGCCTGGTGCCAACAGCATCCCGTGGGTCCTCGAGCAGATCTTGTGTCTGC
AGCAGCAGCAGCTACAGCAGATCCAGCTCACCGAGCAGATCCGCATCCAGGTGAACATGT
GGGCCTCCCACGCCCTCCACTCAAGCGGGGCAGGGGCCGACACTCTGAAGACCTTGGGCA
GCCACATGTCTCAGCAGGTTTCTGCAGCTGTGGCTTTGCTCAGCCAGAAAGCTGGAAGCC
AAGGTCTGTCTCTGGATGCCTTGAAACAAGCCAAGCTACCTCACGCCAACATCCCTTCTG
CCACCAGCTCCCTGTCCCCAGGGCTGGCACCCTTCACTCTGAAGCCGGATGGGACCCGGG
TGCTCCCGAACGTCATGTCCCGCCTCCCGAGCGCTTTGCTTCCTCAGGCCCCGGGCTCGG
TGCTCTTCCAGAGCCCTTTCTCCACTGTGGCRCTAGACACATCCAAGAAAGGGAAGGGGA
AGCCACCGAACATCTCCGCGGTGGATGTCAAACCCAAAGACGAGGCGGCCCTCTACAAGC
ACAAGTGTAAGTACTGTAGCAAGGTTTTTGGGACTGATAGCTCCTTGCAGATCCACCTCC
GCTCCCACACTGGAGAGAGACCCTTCGTGTGCTCTGTCTGTGGTCATCGCTTCACCACCA
AGGGCAACCTCAAGGTGCACTTTCACCGACATCCCCAGGTGAAGGCAAACCCCCAGCTGT
TTGCCGAGTTCCAGGACAAAGTGGCGGCCGGCAATGGCATCCCCTATGCACTCTCTGTAC
CTGACCCCATAGATGAACCGAGTCTTTCTTTAGACAGCAAACCTGTCCTTGTAACCACCT
CTGTAGGGCTACCTCAGAATCTTTCTTCGGGGACTAATCCCAAGGACCTCACGGGTGGCT
CCTTGCCCGGTGACCTGCAGCCTGGGCCTTCTCCAGAAAGTGAGGGTGGACCCACACTCC
CTGGGGTGGGACCAAACTATAATTCCCCAAGGGCTGGTGGCTTCCAAGGGAGTGGGACCC
CTGAGCCAGGGTCAGAGACCCTGAAATTGCAGCAGTTGGTGGAGAACATTGACAAGGCCA
CCACTGATCCCAACGAATGTCTCATTTGCCACCGAGTCTTAAGCTGTCAGAGCTCCCTCA
AGATGCATTATCGCACCCACACCGGGGAGAGACCGTTCCAGTGTAAGATCTGTGGCCGAG
CCTTTTCTACCAAAGGTAACCTGAAGACACACCTTGGGGTTCACCGAACCAACACATCCA
TTAAGACGCAGCATTCGTGCCCCATCTGCCAGAAGAAGTTCACTAATGCCGTGATGCTGC
AGCAACATATTCGGATGCACATGGGCGGTCAGATTCCCAACACGCCCCTGCCAGAGAATC
CCTGTGACTTTACGGGTTCTGAGCCAATGACCGTGGGTGAGAACGGCAGCACCGGCGCTA
TCTGCCATGATGATGTCATCGAAAGCATCGATGTAGAGGAAGTCAGCTCCCAGGAGGCTC
CCAGCAGCTCCTCCAAGGTCCCCACGCCTCTTCCCAGCATCCACTCGGCATCACCCACGC
TAGGGTTTGCCATGATGGCTTCCTTAGATGCCCCAGGGAAAGTGGGTCCTGCCCCTTTTA
ACCTGCAGCGCCAGGGCAGCAGAGAAAACGGTTCCGTGGAGAGCGATGGCTTGACCAACG
ACTCATCCTCGCTGATGGGAGACCAGGAGTATCAGAGCCGAAGCCCAGATATCCTGGAAA
CCACATCCTTCCAGGCACTCTCCCCGGCCAATAGTCAAGCCGAAAGCATCAAGTCAAAGT
CTCCCGATGCTGGGAGCAAAGCAGAGAGCTCCGAGAACAGCCGCACTGAGATGGAAGGTC
GGAGCAGTCTCCCTTCCACGTTTATCCGAGCCCCGCCGACCTATGTCAAGGTTGAAGTTC
CTGGCACATTTGTGGGACCCTCGACATTGTCCCCAGGGATGACCCCTTTGTTAGCAGCCC
AGCCACGCCGACAGGCCAAGCAACATGGCTGCACACGGTGTGGGAAGAACTTCTCCTCTG
CTAGCGCTCTTCAGATCCACGAGCGGACTCACACTGGAGAGAAGCCTTTTGTGTGCAACA
TTTGTGGGCGAGCTTTTACCACCAAAGGCAACTTAAAGGTTCACTACATGACACACGGGG
CGAACAATAACTCAGCCCGCCGTGGAAGGAAGTTGGCCATCGAGAACACCATGGCTCTGT
TAGGTACGGACGGAAAAAGAGTCTCAGAAATCTTTCCCAAGGAAATCCTGGCCCCTTCAG
TGAATGTGGACCCTGTTGTGTGGAACCAGTACACCAGCATGCTCAATGGCGGTCTGGCCG
TGAAGACCAATGAGATCTCTGTGATCCAGAGTGGGGGGGTTCCTACCCTCCCGGTTTCCT
TGGGGGCCACCTCCGTTGTGAATAACGCCACTGTCTCCAAGATGGATGGCTCCCAGTCGG
GTATCAGTGCAGATGTGGAAAAACCAAGTGCTACTGACGGCGTTCCCAAACACCAGTTTC
CTCACTTCCTGGAAGAAAACAAGATTGCGGTCAGCTAAGGGAGAACTTGCGTGGAAGGAG
CAATGCAGACACAGTGAAATCTCTAGAATCTGCTTTGTTTTGTAAGAACTCATCTCCTCC
TGTTTTCTTTTTCTTACTGATATGCAAATGATGTTTACTACGTTGGTTGTGACCACAACC
TCAGGCAAGTGCTACAATCACGATTGTTGCTATGCTGCTTTG
Restriction Sites Please inquire     
ACCN NM_020436
Insert Size 3400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_020436.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020436.2, NP_065169.1
RefSeq Size 3452 bp
RefSeq ORF 3162 bp
Locus ID 57167
UniProt ID Q9UJQ4
Cytogenetics 20q13.2
Protein Families ES Cell Differentiation/IPS, Stem cell - Pluripotency
Gene Summary This gene encodes a zinc finger transcription factor thought to play a role in the development of abducens motor neurons. Defects in this gene are a cause of Duane-radial ray syndrome (DRRS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Other products for "SALL4"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.