PAX5 (NM_016734) Human Untagged Clone

SKU
SC304450
PAX5 (untagged)-Human paired box 5 (PAX5)
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PAX5
Synonyms ALL3; BSAP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_016734 edited
ATGGATTTAGAGAAAAATTATCCGACTCCTCGGACCAGCAGGACAGGACATGGAGGAGTG
AATCAGCTTGGGGGGGTTTTTGTGAATGGACGGCCACTCCCGGATGTAGTCCGCCAGAGG
ATAGTGGAACTTGCTCATCAAGGTGTCAGGCCCTGCGACATCTCCAGGCAGCTTCGGGTC
AGCCATGGTTGTGTCAGCAAAATTCTTGGCAGGTATTATGAGACAGGAAGCATCAAGCCT
GGGGTAATTGGAGGATCCAAACCAAAGGTCGCCACACCCAAAGTGGTGGAAAAAATCGCT
GAATATAAACGCCAAAATCCCACCATGTTTGCCTGGGAGATCAGGGACCGGCTGCTGGCA
GAGCGGGTGTGTGACAATGACACCGTGCCTAGCGTCAGTTCCATCAACAGGATCATCCGG
ACAAAAGTACAGCAGCCACCCAACCAACCAGTCCCAGCTTCCAGTCACAGCATAGTGTCC
ACTGGCTCCGTGACGCAGGTGTCCTCGGTGAGCACGGATTCGGCCGGCTCGTCGTACTCC
ATCAGCGGCATCCTGGGCATCACGTCCCCCAGCGCCGACACCAACAAGCGCAAGAGAGAC
GAAGGTATTCAGGAGTCTCCGGTGCCGAACGGCCACTCGCTTCCGGGCAGAGACTTCCTC
CGGAAGCAGATGCGGGGAGACTTGTTCACACAGCAGCAGCTGGAGGTGCTGGACCGCGTG
TTTGAGAGGCAGCACTACTCAGACATCTTCACCACCACAGAGCCCATCAAGCCCGAGCAG
ACCACAGAGTATTCAGCCATGGCCTCGCTGGCTGGTGGGCTGGACGACATGAAGGCCAAT
CTGGCCAGCCCCACCCCTGCTGACATCGGGAGCAGTGTGCCAGGCCCGCAGTCCTACCCC
ATTGTGACAGGCCGTGACTTGGCGAGCACGACCCTCCCCGGGTACCCTCCACACGTCCCC
CCCGCTGGACAGGGCAGCTACTCAGCACCGACGCTGACAGGGATGGTGCCTGGGAGTGAG
TTTTCCGGGAGTCCCTACAGCCACCCTCAGTATTCCTCGTACAACGACTCCTGGAGGTTC
CCCAACCCGGGGCTGCTTGGCTCCCCCTATTATTATAGCGCTGCCGCCCGAGGAGCCGCC
CCACCTGCAGCCGCCACTGCCTATGACCGTCACTGA
Restriction Sites Please inquire
ACCN NM_016734
Insert Size 1700 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_016734.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016734.1, NP_057953.1
RefSeq Size 3650 bp
RefSeq ORF 1176 bp
Locus ID 5079
UniProt ID Q02548
Cytogenetics 9p13.2
Protein Families Transcription Factors
Summary This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. Paired box transcription factors are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:PAX5 (NM_016734) Human Untagged Clone
Your Rating
SKU Description Size Price
RC222785 PAX5 (Myc-DDK-tagged)-Human paired box 5 (PAX5) 10 ug
$686.00
RC222785L1 Lenti ORF clone of Human paired box 5 (PAX5), Myc-DDK-tagged 10 ug
$986.00
RC222785L2 Lenti ORF clone of Human paired box 5 (PAX5), mGFP tagged 10 ug
$986.00
RC222785L3 Lenti ORF clone of Human paired box 5 (PAX5), Myc-DDK-tagged 10 ug
$986.00
RC222785L4 Lenti ORF clone of Human paired box 5 (PAX5), mGFP tagged 10 ug
$986.00
RG222785 PAX5 (tGFP-tagged) - Human paired box 5 (PAX5) 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.