BMP10 (NM_014482) Human Untagged Clone

SKU
SC304116
BMP10 (untagged)-Human bone morphogenetic protein 10 (BMP10)
$686.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol BMP10
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_014482 edited
ATGGGCTCTCTGGTCCTGACACTGTGCGCTCTTTTCTGCCTGGCAGCTTACTTGGTTTCT
GGCAGCCCCATCATGAACCTAGAGCAGTCTCCTCTGGAAGAAGATATGTCCCTCTTTGGT
GATGTTTTCTCAGAGCAAGACGGTGTCGACTTTAACACACTGCTCCAGAGCATGAAGGAT
GAGTTTCTTAAGACACTAAACCTCTCTGACATCCCCACGCAGGATTCAGCCAAGGTGGAC
CCACCAGAGTACATGTTGGAACTCTACAACAAATTTGCAACAGATCGGACCTCCATGCCC
TCTGCCAACATCATTAGGAGTTTCAAGAATGAAGATCTGTTTTCCCAGCCGGTCAGTTTT
AATGGGCTCCGAAAATACCCCCTCCTCTTCAATGTGTCCATTCCTCACCATGAAGAGGTC
ATCATGACTGAACTTAGGCTATACACACTGGTGCAAAGGGATCGTATGATATACGATGGA
GTAGACCGGAAAATTACCATTTTTGAAGTGCTGGAGAGCAAAGGGGATAATGAGGGAGAA
AGAAACATGCTGGTCTTGGTGTCTGGGGAGATATATGGAACCAACAGTGAGTGGGAGACT
TTTGATGTCACAGATGCCATCAGACGTTGGCAAAAGTCAGGCTCATCCACCCACCAGCTG
GAGGTCCACATTGAGAGCAAACACGATGAAGCTGAGGATGCCAGCAGTGGACGGCTAGAA
ATAGATACCAGTGCCCAGAATAAGCATAACCCTTTGCTCATCGTGTTTTCTGATGACCAA
AGCAGTGACAAGGAGAGGAAGGAGGAACTGAATGAAATGATTTCCCATGAGCAACTTCCA
GAGCTGGACAACTTGGGCCTGGATAGCTTTTCCAGTGGACCTGGGGAAGAGGCTTTGTTG
CAGATGAGATCAAACATCATCTATGACTCCACTGCCCGAATCAGAAGGAACGCCAAAGGA
AACTACTGTAAGAGGACCCCGCTCTACATCGACTTCAAGGAGATTGGGTGGGACTCCTGG
ATCATCGCTCCGCCTGGATACGAAGCCTATGAATGCCGTGGTGTTTGTAACTACCCCCTG
GCAGAGCATCTCACACCCACAAAGCATGCAATTATCCAGGCCTTGGTCCACCTCAAGAAT
TCCCAGAAAGCTTCCAAAGCCTGCTGTGTGCCCACAAAGCTAGAGCCCATCTCCATCCTC
TATTTAGACAAAGGCGTCGTCACCTACAAGTTTAAATACGAAGGCATGGCCGTCTCCGAA
TGTGGCTGTAGATAG
Restriction Sites Please inquire
ACCN NM_014482
Insert Size 1500 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation There is one SNP in ORF.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014482.1, NP_055297.1
RefSeq Size 1584 bp
RefSeq ORF 1275 bp
Locus ID 27302
UniProt ID O95393
Cytogenetics 2p13.3
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which binds to the activin receptor-like kinase 1 (ALK1) and plays important roles in cardiovascular development including cardiomyocyte proliferation and regulation of heart size, closure of the ductus arteriosus, angiogenesis and ventricular trabeculation. [provided by RefSeq, Aug 2016]
Write Your Own Review
You're reviewing:BMP10 (NM_014482) Human Untagged Clone
Your Rating
SKU Description Size Price
RC215695 BMP10 (Myc-DDK-tagged)-Human bone morphogenetic protein 10 (BMP10) 10 ug
$686.00
RC215695L3 Lenti ORF clone of Human bone morphogenetic protein 10 (BMP10), Myc-DDK-tagged 10 ug
$986.00
RC215695L4 Lenti ORF clone of Human bone morphogenetic protein 10 (BMP10), mGFP tagged 10 ug
$986.00
RG215695 BMP10 (tGFP-tagged) - Human bone morphogenetic protein 10 (BMP10) 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.