Bcl2 Binding component 3 (BBC3) (NM_014417) Human Untagged Clone

SKU
SC304096
BBC3 (untagged)-Human BCL2 binding component 3 (BBC3), transcript variant 4
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Bcl2 Binding component 3
Synonyms JFY-1; JFY1; PUMA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_014417 edited
ATGGCCCGCGCACGCCAGGAGGGCAGCTCCCCGGAGCCCGTAGAGGGCCTGGCCCGCGAC
GGCCCGCGCCCCTTCCCGCTCGGCCGCCTGGTGCCCTCGGCAGTGTCCTGCGGCCTCTGC
GAGCCCGGCCTGGCTGCCGCCCCCGCCGCCCCCACCCTGCTGCCCGCTGCCTACCTCTGC
GCCCCCACCGCCCCACCCGCCGTCACCGCCGCCCTGGGGGGTTCCCGCTGGCCTGGGGGT
CCCCGCAGCCGGCCCCGAGGCCCGCGCCCGGACGGTCCTCAGCCCTCGCTCTCGCTGGCG
GAGCAGCACCTGGAGTCGCCCGTGCCCAGCGCCCCGGGGGCTCTGGCGGGCGGTCCCACC
CAGGCGGCCCCGGGAGTCCGCGGGGAGGAGGAACAGTGGGCCCGGGAGATCGGGGCCCAG
CTGCGGCGGATGGCGGACGACCTCAACGCACAGTACGAGCGGCGGAGACAAGAGGAGCAG
CAGCGGCACCGCCCCTCACCCTGGAGGGTCCTGTACAATCTCATCATGGGACTCCTGCCC
TTACCCAGGGGCCACAGAGCCCCCGAGATGGAGCCCAATTAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_014417 unedited
GGTCAAAATTTGTATACGACTCACTATAGGCGGCCGCGNAATTCATGGCCCGCGCACGCC
AGGAGGGCAGCTCCCCGGAGCCCGTAGAGGGCCTGGCCCGCGACGGCCCGCGCCCCTTCC
CGCTCGGCCGCCTGGTGCCCTCGGCAGTGTCCTGCGGCCTCTGCGAGCCCGGCCTGGCTG
CCGCCCCCGCCGCCCCCACCCTGCTGCCCGCTGCCTACCTCTGCGCCCCCACCGCCCCAC
CCGCCGTCACCGCCGCCCTGGGGGGTTCCCGCTGGCCTGGGGGTCCCCGCAGCCGGCCCC
GAGGCCCGCGCCCGGACGGTCCTCAGCCCTCGCTCTCGCTGGCGGAGCAGCACCTGGAGT
CGCCCGTGCCCAGCGCCCCGGGGGCTCTGGCGGGCGGTCCCACCCAGGCGGCCCCGGGAG
TCCGCGGGGAGGAGGAACAGTGGGCCCGGGAGATCGGGGCCCAGCTGCGGCGGATGGCGG
ACGACCTCAACGCACAGTACGAGCGGCGGAGACAAGAGGAGCAGCAGCGGCACCGCCCCT
CACCCTGGAGGGTCCTGTACAATCTCATCATGGGACTCCTGCCCTTACCCAGGGGCCACA
GAGCCCCCGAGATGGAGCCCAATTAGCTCGACTCTAGATTGCGGCCGCGGTCATAGCTGT
TTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCT
GGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATAAGTTGCATCATTTTG
TCTGACTAGGTGTCCTTCTATATATTATGGGGTGGAGGGGGGTGGGNTTTTGAAACAAGG
GGGAAATTTGGGAAGAAAAACCCTTAGGGGCTGGCGGGGGTCTATGGGGAACCAAGCTGG
ATGGCAG
Restriction Sites Please inquire
ACCN NM_014417
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014417.2, NP_055232.1
RefSeq Size 1840 bp
RefSeq ORF 582 bp
Locus ID 27113
UniProt ID Q9BXH1
Cytogenetics 19q13.32
Protein Families Druggable Genome
Protein Pathways Huntington's disease, p53 signaling pathway
Summary This gene encodes a member of the BCL-2 family of proteins. This family member belongs to the BH3-only pro-apoptotic subclass. The protein cooperates with direct activator proteins to induce mitochondrial outer membrane permeabilization and apoptosis. It can bind to anti-apoptotic Bcl-2 family members to induce mitochondrial dysfunction and caspase activation. Because of its pro-apoptotic role, this gene is a potential drug target for cancer therapy and for tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (4) has alternate exon structure at its 5' end and it thus differs in the 5' UTR and 5' coding region, compared to variant 2. The encoded isoform (4, also known as PUMA-alpha) has a distinct N-terminus and is longer than isoform 2. Isoform 4 also includes the C-terminal BH3 domain and can localize to the mitochondria.
Write Your Own Review
You're reviewing:Bcl2 Binding component 3 (BBC3) (NM_014417) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213203 BBC3 (Myc-DDK-tagged)-Human BCL2 binding component 3 (BBC3), transcript variant 4 10 ug
$300.00
RC213203L1 Lenti ORF clone of Human BCL2 binding component 3 (BBC3), transcript variant 4, Myc-DDK-tagged 10 ug
$600.00
RC213203L2 Lenti ORF clone of Human BCL2 binding component 3 (BBC3), transcript variant 4, mGFP tagged 10 ug
$600.00
RC213203L3 Lenti ORF clone of Human BCL2 binding component 3 (BBC3), transcript variant 4, Myc-DDK-tagged 10 ug
$600.00
RC213203L4 Lenti ORF clone of Human BCL2 binding component 3 (BBC3), transcript variant 4, mGFP tagged 10 ug
$600.00
RG213203 BBC3 (tGFP-tagged) - Human BCL2 binding component 3 (BBC3), transcript variant 4 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.