SMR3A (NM_012390) Human Untagged Clone

SKU SC303974

SMR3A (untagged)-Human submaxillary gland androgen regulated protein 3A (SMR3A)

Product Data

• Type: Human Untagged Clone
• Target Symbol: SMR3A
• Synonyms: P-B1; PBI; PRL5; PROL5
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_012390 edited; ATGAAATCACTGACTTGGATCTTGGGCCTTTGGGCTCTTGCAGCGTGTTTCACACCTGGT; GAGAGTCAAAGAGGCCCCAGGGGACCATATCCACCTGGACCACTGGCTCCTCCTCCTCCA; CCATGTTTTCCTTTTGGAACAGGATTTGTTCCACCACCCCATCCTCCACCCTATGGTCCA; GGGAGATTTCCACCACCCCTTTCTCCACCCTATGGTCCAGGGAGAATCCCACCATCCCCT; CCTCCACCCTATGGTCCAGGGAGAATTCAATCACACTCTCTTCCTCCTCCTTATGGCCCA; GGTTATCCACAGCCACCTTCCCAACCAAGACCCTATCCACCTGGACCTCCATTTTTCCCT; GTAAATTCTCCAACTGATCCTGCCCTCCCTACTCCTGCACCCTAA;
• Restriction Sites: Please inquire
• ACCN: NM_012390
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_012390.3, NP_036522.3
• RefSeq Size: 598 bp
• RefSeq ORF: 405 bp
• Locus ID: 26952
• UniProt ID: Q99954
• Cytogenetics: 4q13.3
• Protein Families: Secreted Protein
• Summary: May play a role in protection or detoxification.[UniProtKB/Swiss-Prot Function]