TIM 1 (HAVCR1) (NM_012206) Human Untagged Clone

SKU
SC303942
HAVCR1 (untagged)-Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1
$732.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TIM 1
Synonyms CD365; HAVCR; HAVCR-1; KIM-1; KIM1; TIM; TIM-1; TIM1; TIMD-1; TIMD1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303942 representing NM_012206.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCATCCTCAAGTGGTCATCTTAAGCCTCATCCTACATCTGGCAGATTCTGTAGCTGGTTCTGTAAAG
GTTGGTGGAGAGGCAGGTCCATCTGTCACACTACCCTGCCACTACAGTGGAGCTGTCACATCCATGTGC
TGGAATAGAGGCTCATGTTCTCTATTCACATGCCAAAATGGCATTGTCTGGACCAATGGAACCCACGTC
ACCTATCGGAAGGACACACGCTATAAGCTATTGGGGGACCTTTCAAGAAGGGATGTCTCTTTGACCATA
GAAAATACAGCTGTGTCTGACAGTGGCGTATATTGTTGCCGTGTTGAGCACCGTGGGTGGTTCAATGAC
ATGAAAATCACCGTATCATTGGAGATTGTGCCACCCAAGGTCACGACTACTCCAATTGTCACAACTGTT
CCAACCGTCACGACTGTTCGAACGAGCACCACTGTTCCAACGACAACGACTGTTCCAATGACGACTGTT
CCAACGACAACTGTTCCAACAACAATGAGCATTCCAACGACAACGACTGTTCTGACGACAATGACTGTT
TCAACGACAACGAGCGTTCCAACGACAACGAGCATTCCAACAACAACAAGTGTTCCAGTGACAACAACT
GTCTCTACCTTTGTTCCTCCAATGCCTTTGCCCAGGCAGAACCATGAACCAGTAGCCACTTCACCATCT
TCACCTCAGCCAGCAGAAACCCACCCTACGACACTGCAGGGAGCAATAAGGAGAGAACCCACCAGCTCA
CCATTGTACTCTTACACAACAGATGGGAATGACACCGTGACAGAGTCTTCAGATGGCCTTTGGAATAAC
AATCAAACTCAACTGTTCCTAGAACATAGTCTACTGACGGCCAATACCACTAAAGGAATCTATGCTGGA
GTCTGTATTTCTGTCTTGGTGCTTCTTGCTCTTTTGGGTGTCATCATTGCCAAAAAGTATTTCTTCAAA
AAGGAGGTTCAACAACTAAGTGTTTCATTTAGCAGCCTTCAAATTAAAGCTTTGCAAAATGCAGTTGAA
AAGGAAGTCCAAGCAGAAGACAATATCTACATTGAGAATAGTCTTTATGCCACGGACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_012206
Insert Size 1095 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_012206.3
RefSeq Size 1713 bp
RefSeq ORF 1095 bp
Locus ID 26762
UniProt ID Q96D42
Cytogenetics 5q33.3
Protein Families Druggable Genome, Transmembrane
MW 39.2 kDa
Summary The protein encoded by this gene is a membrane receptor for both human hepatitis A virus (HHAV) and TIMD4. The encoded protein may be involved in the moderation of asthma and allergic diseases. The reference genome represents an allele that retains a MTTVP amino acid segment that confers protection against atopy in HHAV seropositive individuals. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4, 12 and 19. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (1) encodes the shorter isoform (a). Both variants 1 and 3 encode isoform a.
Write Your Own Review
You're reviewing:TIM 1 (HAVCR1) (NM_012206) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217039 HAVCR1 (Myc-DDK-tagged)-Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1 10 ug
$686.00
RC217039L1 Lenti ORF clone of Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC217039L2 Lenti ORF clone of Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1, mGFP tagged 10 ug
$986.00
RC217039L3 Lenti ORF clone of Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC217039L4 Lenti ORF clone of Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1, mGFP tagged 10 ug
$986.00
RG217039 HAVCR1 (tGFP-tagged) - Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1 10 ug
$489.00 MSRP $886.00 MSRP $886.00
SC317584 HAVCR1 (untagged)-Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 1 10 ug
$686.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.