FOXD4L1 (NM_012184) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | FOXD4L1 |
Synonyms | bA395L14.1; FOXD5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_012184 edited
ATGAACCTGCCAAGAGCTGAGCGCCCTCGCTCCACACCGCAGCGCAGCCTCCGGGACTCC GATGGGGAAGACGGTAAAATCGATGTCCTGGGAGAGGAGGAAGATGAAGACGAGGTGGAA GACGAGGAGGAGGAGGCGAGCCAGAAGTTCCTAGAGCAGTCGCTCCAGCCGGGGCTGCAG GTGGCCCGGTGGGGCGGGGTTGCGCTTCCCCGAGAGCACATCGAGGGCGGCGGCCCGAGC GACCCCTCAGAGTTTGGCACCGAGTTCAGGGCACCGCCAAGGTCTGCGGCGGCCTCTGAA GATGCCCGGCAGCCGGCAAAGCCCCCCTACTCGTACATCGCGCTCATCACCATGGCCATC CTGCAAAGCCCGCACAAGCGCCTCACGCTCAGCGGCATCTGCGCCTTCATTAGTGGCCGC TTCCCCTACTACCGCCGCAAGTTCCCCGCCTGGCAGAACAGCATCCGCCACAACCTCTCG CTGAACGACTGCTTCGTCAAGATCCCCCGCGAGCCGGGCCACCCAGGCAAGGGCACCTAC TGGAGCCTGGACCCCGCCTCCCAGGACATGTTCGACAATGGCAGCTTTCTCCGGCGTAGG AAGCGTTTCAAGCGCCACCAACTGACCCCGGGAGCCCACCTGCCCCACCCCTTCCCTCTA CCTGCTGCACACGCCGCCCTGCACAACCCCCGCCCAGGCCCTCTGCTTGGGGCCCCTGCC CTGCCGCAGCCAGTCCCGGGGGCCTACCCCAACACCGCCCCCGGGAGACGCCCTTACGCT CTGCTGCACCCGCATCCTCCTCGCTACCTACTGCTCTCGGCCCCCGCCTATGCCGGGGCA CCGAAGAAAGCAGAAGGCGCGGACCTGGCGACCCCCGGCACCCTTCCCGTGCTGCAGCCC TCACTTGGTCCTCAGCCTTGGGAGGAGGGCAAGGGTCTGGCGTCGCCACCGGGAGGCGGA TGCATCTCTTTCAGCATTGAGAGTATCATGCAAGGGGTCAGGGGAGCGGGTACAGGGGCT GCGCAGAGTTTGTCCCCGACCGCGTGGAGCTACTGCCCCCTGCTCCAGCGACCGTCAAGC CTGTCGGACAATTTTGCAGCAACAGCAGCAGCATCAGGAGGAGGACTGCGCCAACGGCTG CGCTCCCACCAAGGGCGCGGTGCTGGGCGGGCACCTGTCGGCCGCGTCGGCGCTGCTGCG GTATCAGGCGGTGGCAGAGGGCTCTAG |
Restriction Sites | Please inquire |
ACCN | NM_012184 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_012184.3, NP_036316.1 |
RefSeq Size | 2250 bp |
RefSeq ORF | 1227 bp |
Locus ID | 200350 |
UniProt ID | Q9NU39 |
Cytogenetics | 2q14.1 |
Summary | This gene is a member of the forkhead/winged-helix (FOX) family of transcription factors with highly conserved FOX DNA-binding domains. Members of the FOX family of transcription factors are regulators of embryogenesis and may play a role in human cancer. This gene lies in a region of chromosome 2 that surrounds the site where two ancestral chromosomes fused to form human chromosome 2. This region is duplicated elsewhere in the human genome, primarily in subtelomeric and pericentromeric locations, thus mutiple copies of this gene have been found. [provided by RefSeq, Jul 2008] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC223243 | FOXD4L1 (Myc-DDK-tagged)-Human forkhead box D4-like 1 (FOXD4L1) | 10 ug |
$457.00
|
|
RC223243L3 | Lenti ORF clone of Human forkhead box D4-like 1 (FOXD4L1), Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC223243L4 | Lenti ORF clone of Human forkhead box D4-like 1 (FOXD4L1), mGFP tagged | 10 ug |
$757.00
|
|
RG223243 | FOXD4L1 (tGFP-tagged) - Human forkhead box D4-like 1 (FOXD4L1) | 10 ug |
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.