Septin 2 (SEPT2) (NM_006155) Human Untagged Clone

SKU
SC303739
41519 (untagged)-Human septin 2 (SEPT2), transcript variant 2
$503.00
4 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Septin 2
Synonyms DIFF6; hNedd5; NEDD-5; NEDD5; Pnutl3; SEPT2
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_006155, the custom clone sequence may differ by one or more nucleotides
ATGTCTAAGCAACAGCCAACTCAGTTTATAAATCCAGAAACACCTGGCTATGTTGGATTT
GCAAACCTCCCCAATCAAGTTCACCGAAAATCAGTGAAAAAAGGTTTTGAGTTCACACTG
ATGGTGGTCGGTGAATCAGGTCTAGGAAAATCGACTCTCATAAACAGCCTATTCCTAACT
GATCTGTACCCAGAAAGAGTCATACCTGGAGCAGCAGAAAAAATTGAAAGAACTGTCCAG
ATTGAGGCTTCAACTGTTGAAATTGAAGAGCGAGGGGTCAAGCTACGCCTGACAGTGGTA
GATACCCCTGGCTATGGTGACGCTATCAACTGCAGAGATTGTTTTAAGACAATTATCTCC
TATATTGATGAGCAATTTGAGAGGTACCTGCATGACGAGAGCGGCTTGAACAGGCGGCAC
ATCATTGATAATAGGGTGCATTGTTGCTTTTACTTTATTTCACCTTTTGGACATGGACTT
AAGCCCTTAGATGTGGCGTTTATGAAGGCAATACACAACAAGGTGAATATTGTGCCTGTC
ATTGCAAAAGCTGACACTCTCACCCTGAAGGAACGGGAGCGGCTGAAGAAAAGGATTCTG
GATGAAATTGAAGAACATAACATCAAAATCTATCACTTACCTGATGCAGAATCAGATGAA
GATGAAGATTTTAAAGAGCAGACTAGACTTCTCAAGGCTAGCATCCCATTCTCTGTGGTT
GGATCCAATCAGTTGATTGAAGCCAAAGGAAAGAAGGTCAGAGGCCGCCTCTACCCCTGG
GGTGTTGTGGAAGTGGAGAACCCAGAGCACAATGACTTTCTGAAGCTGAGAACCATGCTC
ATCACCCACATGCAGGATCTCCAGGAGGTGACCCAGGACCTTCATTATGAAAACTTCCGT
TCTGAGAGACTCAAGAGAGGCGGCAGGAAAGTGGAGAATGAGGACATGAATAAAGACCAG
ATCTTGCTGGAAAAAGAAGCTGAGCTCCGCCGCATGCAAGAGATGATTGCAAGGATGCAG
GCGCAGATGCAGATGCAGATGCAGGGCGGGGATGGCGATGGCGGGGCTCTCGGGCACCAC
GTGTAA
Restriction Sites Please inquire
ACCN NM_006155
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006155.1, NP_006146.1
RefSeq Size 3497 bp
RefSeq ORF 1086 bp
Locus ID 4735
UniProt ID Q15019
Cytogenetics 2q37.3
Summary Filament-forming cytoskeletal GTPase. Forms a filamentous structure with SEPTIN12, SEPTIN6, SEPTIN2 and probably SEPTIN4 at the sperm annulus which is required for the structural integrity and motility of the sperm tail during postmeiotic differentiation (PubMed:25588830). Required for normal organization of the actin cytoskeleton. Plays a role in the biogenesis of polarized columnar-shaped epithelium by maintaining polyglutamylated microtubules, thus facilitating efficient vesicle transport, and by impeding MAP4 binding to tubulin. Required for the progression through mitosis. Forms a scaffold at the midplane of the mitotic splindle required to maintain CENPE localization at kinetochores and consequently chromosome congression. During anaphase, may be required for chromosome segregation and spindle elongation. Plays a role in ciliogenesis and collective cell movements. In cilia, required for the integrity of the diffusion barrier at the base of the primary cilium that prevents diffusion of transmembrane proteins between the cilia and plasma membranes: probably acts by regulating the assembly of the tectonic-like complex (also named B9 complex) by localizing TMEM231 protein. May play a role in the internalization of 2 intracellular microbial pathogens, Listeria monocytogenes and Shigella flexneri.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1-4, 8-13, and 16-18 encode the same isoform (a).
Write Your Own Review
You're reviewing:Septin 2 (SEPT2) (NM_006155) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211473 SEPT2 (Myc-DDK-tagged)-Human septin 2 (SEPT2), transcript variant 2 10 ug
$457.00
RC211473L3 Lenti-ORF clone of 41519 (Myc-DDK-tagged)-Human septin 2 (SEPT2), transcript variant 2 10 ug
$757.00
RC211473L4 Lenti-ORF clone of 41519 (mGFP-tagged)-Human septin 2 (SEPT2), transcript variant 2 10 ug
$757.00
RG211473 SEPT2 (tGFP-tagged)-Human septin 2 (SEPT2), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.