Eotaxin 3 (CCL26) (NM_006072) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Eotaxin 3 |
Synonyms | IMAC; MIP-4a; MIP-4alpha; SCYA26; TSC-1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_006072 edited
CAGGCAGGAGGAGTTTGGGAGAAACCTGAGAAGGGCCTGATTTGCAGCATCATGATGGGC CTCTCCTTGGCCTCTGCTGTGCTCCTGGCCTCCCTCCTGAGTCTCCACCTTGGAACTGCC ACACGTGGGAGTGACATATCCAAGACCTGCTGCTTCCAATACAGCCACAAGCCCCTTCCC TGGACCTGGGTGCGAAGCTATGAATTCACCAGTAACAGCTGCTCCCAGCGGGCTGTGATA TTCACTACCAAAAGAGGCAAGAAAGTCTGTACCCATCCAAGGAAAAAATGGGTGCAAAAA TACATTTCTTTACTGAAAACTCCGAAACAATTGTGACTCAGCTGAATTGTCATCCGAGGA CGCTTGGACCCCGCTCTTGGCTCTGC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006072 unedited
NGGAAGGTCAGATTTGTTTACGACTTATATAGGCGGCCGCGCATTCANATCTGGTACCGG GCCCCCCCNTCGGGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGG ATCCGCCCAGGCAGGAGGAGTTTGGGAGAAACCTGAGAAGGGCCTGATTTGCAGCATCAT GATGGGCCTCTCCTTGGCCTCTGCTGTGCTCCTGGCCTCCCTCCTGAGTCTCCACCTTGG AACTGCCACACGTGGGAGTGACATATCCAAGACCTGCTGCTTCCAATACAGCCACAAGCC CCTTCCCTGGACCTGGGTGCGAAGCTATGAATTCACCAGTAACAGCTGCTCCCAGCGGGC TGTGATATTCACTACCAAAAGAGGCAAGAAAGTCTGTACCCATCCAAGGAAAAAATGGGT GCAAAAATACATTTCTTTACTGAAAACTCCGAAACAATTGTGACTCAGCTGAATTGTCAT CCGAGGACGCTTGGACCCCGCTCTTGGCTCTGCGGGCTAGAGCGGCCGCGGTCATAGCTG TTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCC TGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATAAGTTGCATCATTTT GTCTGACTAGGTGTCCTTCTATAATATTATGGNGTGGAAGGGGGTGGTATGGAGCAAGGG CAAGTTGGGAAAACAACCTGTTAGGCCTGCGGGGTCTATTGGGAACCCAAGCTGAGTGCA GTGGCCCAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGGCT TAACCTTCCCGATTTGTTGGGATTCCGGCCTGCCTGGACCGGGTTAAGTTAATTTTGGTT TTTTG |
Restriction Sites | Please inquire |
ACCN | NM_006072 |
Insert Size | 400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_006072.4, NP_006063.1 |
RefSeq Size | 562 bp |
RefSeq ORF | 285 bp |
Locus ID | 10344 |
UniProt ID | Q9Y258 |
Cytogenetics | 7q11.23 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
Summary | This gene is one of two Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 7. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for normal peripheral blood eosinophils and basophils. This protein also has antimicrobial activity, displaying an antibacterial effect on S. pneumoniae, S. aureus, Non-typeable H. influenzae, and P. aeruginosa. The product of this gene is one of three related chemokines that specifically activate chemokine receptor CCR3. This chemokine may contribute to the eosinophil accumulation in atopic diseases. [provided by RefSeq, Jul 2020] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC212044 | CCL26 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 26 (CCL26) | 10 ug |
$150.00
|
|
RC212044L1 | Lenti ORF clone of Human chemokine (C-C motif) ligand 26 (CCL26), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC212044L2 | Lenti ORF clone of Human chemokine (C-C motif) ligand 26 (CCL26), mGFP tagged | 10 ug |
$450.00
|
|
RC212044L3 | Lenti ORF clone of Human chemokine (C-C motif) ligand 26 (CCL26), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC212044L4 | Lenti ORF clone of Human chemokine (C-C motif) ligand 26 (CCL26), mGFP tagged | 10 ug |
$450.00
|
|
RG212044 | CCL26 (tGFP-tagged) - Human chemokine (C-C motif) ligand 26 (CCL26) | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.