SIX3 (NM_005413) Human Untagged Clone

CAT#: SC303639

SIX3 (untagged)-Human SIX homeobox 3 (SIX3)


  "NM_005413" in other vectors (6)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
SIX3 mouse monoclonal antibody,clone OTI7G9
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SIX3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SIX3
Synonyms HPE2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303639 representing NM_005413.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTATTCCGCTCCCCCCTAGACCTCTATTCCTCCCACTTCTTGTTGCCAAACTTCGCCGATTCTCAC
CACCGCTCCATACTTCTGGCGAGTAGCGGCGGCGGGAACGGTGCGGGAGGCGGCGGCGGCGCGGGAGGC
GGCAGCGGCGGCGGGAACGGTGCGGGAGGCGGCGGTGCTGGCGGAGCAGGCGGCGGCGGCGGCGGCGGC
TCCAGGGCCCCCCCGGAAGAGTTGTCCATGTTCCAGCTGCCCACCCTCAACTTCTCGCCGGAGCAGGTG
GCCAGCGTCTGTGAGACGCTGGAGGAGACGGGCGACATCGAGCGGCTGGGCCGCTTCCTCTGGTCGCTG
CCCGTGGCCCCCGGGGCGTGCGAGGCCATCAACAAACACGAGTCGATCCTGCGCGCGCGCGCCGTGGTC
GCCTTCCACACGGGCAACTTCCGCGACCTCTACCACATCCTTGAGAACCACAAGTTCACCAAGGAGTCT
CACGGCAAGCTGCAGGCCATGTGGCTCGAGGCGCACTACCAGGAGGCCGAGAAGCTGCGCGGCCGCCCA
CTCGGCCCGGTGGACAAGTACCGCGTGCGCAAGAAGTTCCCGCTGCCACGCACCATCTGGGACGGCGAG
CAGAAGACGCATTGCTTCAAGGAGCGGACTCGGAGCCTGTTGCGGGAGTGGTACCTACAGGACCCCTAC
CCCAACCCCAGCAAGAAACGCGAACTGGCGCAGGCCACCGGCCTCACTCCCACACAAGTAGGCAACTGG
TTTAAGAACCGGCGGCAGCGCGACCGCGCCGCGGCGGCCAAGAACAGGCTCCAGCACCAGGCCATTGGA
CCGAGCGGCATGCGCTCGCTGGCCGAGCCCGGCTGCCCCACGCACGGCTCGGCAGAGTCGCCGTCCACG
GCGGCCAGCCCGACCACCAGCGTGTCCAGCCTGACGGAGCGCGCAGACACCGGCACCTCCATCCTCTCG
GTAACCTCCAGCGACTCGGAATGTGATGTATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_005413
Insert Size 999 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005413.3
RefSeq Size 2533 bp
RefSeq ORF 999 bp
Locus ID 6496
UniProt ID O95343
Cytogenetics 2p21
Protein Families Druggable Genome
MW 35.5 kDa
Gene Summary This gene encodes a member of the sine oculis homeobox transcription factor family. The encoded protein plays a role in eye development. Mutations in this gene have been associated with holoprosencephaly type 2. [provided by RefSeq, Oct 2009]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.