Neurturin (NRTN) (NM_004558) Human Untagged Clone

SKU
SC303499
NRTN (untagged)-Human neurturin (NRTN)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Neurturin
Synonyms NTN
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004558 edited
ATGCAGCGCTGGAAGGCGGCGGCCTTGGCCTCAGTGCTCTGCAGCTCCGTGCTGTCCATC
TGGATGTGTCGAGAGGGCCTGCTTCTCAGCCACCGCCTCGGACCTGCGCTGGTCCCCCTG
CACCGCCTGCCTCGAACCCTGGACGCCCGGATTGCCCGCCTGGCCCAGTACCGTGCACTC
CTGCAGGGGGCCCCGGATGCGATGGAGCTGCGCGAGCTGACGCCCTGGGCTGGGCGGCCC
CCAGGTCCGCGCCGTCGGGCGGGGCCCCGGCGGCGGCGCGCGCGTGCGCGGTTGGGGGCG
CGGCCTTGCGGGCTGCGCGAGCTGGAGGTGCGCGTGAGCGAGCTGGGCCTGGGCTACGCG
TCCGACGAGACGGTGCTGTTCCGCTACTGCGCAGGCGCCTGCGAGGCTGCCGCGCGCGTC
TACGACCTCGGGCTGCGACGACTGCGCCAGCGGCGGCGCCTGCGGCGGGAGCGGGTGCGC
GCGCAGCCCTGCTGCCGCCCGACGGCCTACGAGGACGAGGTGTCCTTCCTGGACGCGCAC
AGCCGCTACCACACGGTGCACGAGCTGTCGGCGCGCGAGTGCGCCTGCGTGTGA
Restriction Sites Please inquire
ACCN NM_004558
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004558.2, NP_004549.1
RefSeq Size 1159 bp
RefSeq ORF 594 bp
Locus ID 4902
UniProt ID Q99748
Cytogenetics 19p13.3
Protein Families Druggable Genome, Secreted Protein
Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein signals through the RET receptor tyrosine kinase and a GPI-linked coreceptor, and promotes survival of neuronal populations. A neurturin mutation has been described in a family with Hirschsprung Disease. [provided by RefSeq, Aug 2016]
Write Your Own Review
You're reviewing:Neurturin (NRTN) (NM_004558) Human Untagged Clone
Your Rating
SKU Description Size Price
RC214513 NRTN (Myc-DDK-tagged)-Human neurturin (NRTN) 10 ug
$450.00
RC214513L3 Lenti-ORF clone of NRTN (Myc-DDK-tagged)-Human neurturin (NRTN) 10 ug
$750.00
RC214513L4 Lenti-ORF clone of NRTN (mGFP-tagged)-Human neurturin (NRTN) 10 ug
$750.00
RG214513 NRTN (tGFP-tagged) - Human neurturin (NRTN) 10 ug
$650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.