FABP3 (NM_004102) Human Untagged Clone

CAT#: SC303434

FABP3 (untagged)-Human fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) (FABP3)


  "NM_004102" in other vectors (5)

Reconstitution Protocol

USD 165.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


FABP3 mouse monoclonal antibody, clone OTI2G2
    • 100 ul

USD 447.00

Other products for "FABP3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FABP3
Synonyms FABP11; H-FABP; M-FABP; MDGI; O-FABP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303434 representing NM_004102.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGGACGCTTTCCTGGGCACCTGGAAGCTAGTGGACAGCAAGAATTTCGATGACTACATGAAGTCA
CTCGGTGTGGGTTTTGCTACCAGGCAGGTGGCCAGCATGACCAAGCCTACCACAATCATCGAAAAGAAT
GGGGACATTCTCACCCTAAAAACACACAGCACCTTCAAGAACACAGAGATCAGCTTTAAGTTGGGGGTG
GAGTTCGATGAGACAACAGCAGATGACAGGAAGGTCAAGTCCATTGTGACACTGGATGGAGGGAAACTT
GTTCACCTGCAGAAATGGGACGGGCAAGAGACCACACTTGTGCGGGAGCTAATTGATGGAAAACTCATC
CTGACACTCACCCACGGCACTGCAGTTTGCACTCGCACTTATGAGAAAGAGGCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_004102
Insert Size 402 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004102.4
RefSeq Size 1309 bp
RefSeq ORF 402 bp
Locus ID 2170
UniProt ID P05413
Cytogenetics 1p35.2
Protein Pathways PPAR signaling pathway
MW 14.9 kDa
Gene Summary The intracellular fatty acid-binding proteins (FABPs) belongs to a multigene family. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Fatty acid-binding protein 3 gene contains four exons and its function is to arrest growth of mammary epithelial cells. This gene is a candidate tumor suppressor gene for human breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.