beta Arrestin 1(ARRB1) (NM_004041) Human Untagged Clone

CAT#: SC303424

ARRB1 (untagged)-Human arrestin, beta 1 (ARRB1), transcript variant 1

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name beta Arrestin 1(ARRB1) (NM_004041) Human Untagged Clone
Symbol ARRB1
Synonyms ARB1; ARR1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004041 edited
CCGCGCTCCTCCTGCTGGCTGGGGATTTTCCAGCCTGGGCGCTGACGCCGCGGACCTCCC
TGCGACCGTCGCGGACCATGGGCGACAAAGGGACCCGAGTGTTCAAGAAGGCCAGTCCAA
ATGGAAAGCTCACCGTCTACCTGGGAAAGCGGGACTTTGTGGACCACATCGACCTCGTGG
ACCCTGTGGATGGTGTGGTCCTGGTGGATCCTGAGTATCTCAAAGAGCGGAGAGTCTATG
TGACGCTGACCTGCGCCTTCCGCTATGGCCGGGAGGACCTGGATGTCCTGGGCCTGACCT
TTCGCAAGGACCTGTTTGTGGCCAACGTACAGTCGTTCCCACCGGCCCCCGAGGACAAGA
AGCCCCTGACGCGGCTGCAGGAACGCCTCATCAAGAAGCTGGGCGAGCACGCTTACCCTT
TCACCTTTGAGATCCCTCCAAACCTTCCATGTTCTGTGACACTGCAGCCGGGGCCCGAAG
ACACGGGGAAGGCTTGCGGTGTGGACTATGAAGTCAAAGCCTTCTGCGCGGAGAATTTGG
AGGAGAAGATCCACAAGCGGAATTCTGTGCGTCTGGTCATCCGGAAGGTTCAGTATGCCC
CAGAGAGGCCTGGCCCCCAGCCCACAGCCGAGACCACCAGGCAGTTCCTCATGTCGGACA
AGCCCTTGCACCTAGAAGCCTCTCTGGATAAGGAGATCTATTACCATGGAGAACCCATCA
GCGTCAACGTCCACGTCACCAACAACACCAACAAGACGGTGAAGAAGATCAAGATCTCAG
TGCGCCAGTATGCAGACATCTGCCTTTTCAACACAGCTCAGTACAAGTGCCCTGTTGCCA
TGGAAGAGGCTGATGACACTGTGGCACCCAGCTCGACGTTCTGCAAGGTCTACACACTGA
CCCCCTTCCTAGCCAATAACCGAGAGAAGCGGGGCCTCGCCTTGGACGGGAAGCTCAAGC
ACGAAGACACGAACTTGGCCTCTAGCACCCTGTTGAGGGAAGGTGCCAACCGTGAGATCC
TGGGGATCATTGTTTCCTACAAAGTGAAAGTGAAGCTGGTGGTGTCTCGGGGCGGCCTGT
TGGGAGATCTTGCATCCAGCGACGTGGCCGTGGAACTGCCCTTCACCCTAATGCACCCCA
AGCCCAAAGAGGAACCCCCGCATCGGGAAGTTCCAGAGAACGAGACGCCAGTAGATACCA
ATCTCATAGAACTTGACACAAATGATGACGACATTGTATTTGAGGACTTTGCTCGCCAGA
GACTGAAAGGCATGAAGGATGACAAGGAGGAAGAGGAGGATGGTACCGGCTCTCCACAGC
TCAACAACAGATAGACGGGCCGGCCCTGCCTCCACGTGGCTCCGGCTCCACTCTCGTGCA
CTCGGATGCTTACTCGTCTTCTTCCTGTTCTGGTTTCTTTTCCCCTTTGTTCTTCCAGTT
TCTACCAGGGGGCCCCGTGGGCTTCCAGATCACGGTGATGAACCTCTGGCCTCAGGATTG
GCCCCACATCACCACGCCAACAGGACCACAGCGCACTGGCTCCACCCCATCTCTGCCATC
TCCACTCCCCTCCTTTTCATGCTGTCTCCCAGAAAAGCTGCCAGGGCTCTGGCCTTGGAA
TTGGACTTGAGATGGGGAGCAGACAGGGGAGGATGGGGAATGTGGGACACGGTGTGGTGG
GCATGAGGGCTTGGAGGGGTGGGGATGAGGGCTCAAGACACGAGAGAAGATGTCCACGGT
CCCAGGTGGTTAACAAAGTTCTGGCAGCTAAAAGATGACCGCGTTGAAGGCCACCTCCTT
CTGGCTGGGAGGGGCAGAACTGTGGACAGATTCTCAATGCCTTTTTGAAGTTCTGACCCA
CCAAAGACCTTCTGCCTTCACCCTCCTCCCCACCTGATGTCCCTCTGTGTCTGATAGTGA
TGTTGGTGAAAGTTCGTAGACCCCAGGAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for BC003636 unedited
NNAACGGCAACATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGCCGCG
CTCCTCCTGCTGGCTGGGGATTTTCCAGCCTGGGCGCTGACGCCGCGGACCTCCCTGCGA
CCGTCGCGGACCATGGGCGACAAAGGGACCCGAGTGTTCAAGAAGGCCAGTCCAAATGGA
AAGCTCACCGTCTACCTGGGAAAGCGGGACTTTGTGGACCACATCGACCTCGTGGACCCT
GTGGATGGTGTGGTCCTGGTGGATCCTGAGTATCTCAAAGAGCGGAGAGTCTATGTGACG
CTGACCTGCGCCTTCCGCTATGGCCGGGAGGACCTGGATGTCCTGGGCCTGACCTTTCGC
AAGGACCTGTTTGTGGCCAACGTACAGTCGTTCCCACCGGCCCCCGAGGACAAGAAGCCC
CTGACGCGGCTGCAGGAACGCCTCATCAAGAAGCTGGGCGAGCACGCTTACCCTTTCACC
TTTGAGATCCCTCCAAACCTTCCATGTTCTGTGACACTGCAGCCGGGGCCCGAAGACACG
GGGAAGGCTTGCGGTGTGGACTATGAAGTCAAAGCCTTCTGCGCGGAGAATTTGGAGGAG
AAGATCCACAAGCGGAATTCTGTGCGTCTGGTCATCCGGAAGGTTCAGTATGCCCCAGAG
AGGCCTGGCCCCCAGCCCACAGCCGAGACCACCAGGCAGTTCCTCATGTCGGACAAGCCC
TTGCACCTAGAAGCCTCTCTGGATAAGGAGATCTATTACCATGGAGAACCCATCAGCGTC
AACGTCCACGTCACCAACAACACCAACAAGACGGTGAAGAAGATCAAGATCTCAGTGCGC
CAGTATGCAGACATCTGCCTTTTCACACAGCTCANTACAGTGCCCTGNTGCCATG
Tag Tag Free
ACCN NM_004041
ORF Size 1257 bp
Insert Size 2000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation ORF matches to NM_004041.3.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004041.3, NP_004032
RefSeq Size 2204
RefSeq ORF 1257
Locus ID 408
Cytogenetics 11q13.4
Protein Families Druggable Genome
Protein Pathways MAPK signaling pathway, Chemokine signaling pathway, Endocytosis
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations