PAX2 (NM_003988) Human Untagged Clone

SKU
SC303413
PAX2 (untagged)-Human paired box 2 (PAX2), transcript variant c
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PAX2
Synonyms FSGS7; PAPRS
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003988 edited
CCTCCCTTTTCTCCTCAAGTCCTGAAGTTGAGTTTGAGAGGCGACACGGCGGCGGCGGCC
GCGCTGCTCCCGCTCCTCTGCCTCCCCATGGATATGCACTGCAAAGCAGACCCCTTCTCC
GCGATGCACCCAGGGCACGGGGGTGTGAACCAGCTCGGGGGGGTGTTTGTGAACGGCCGG
CCCCTACCCGACGTGGTGAGGCAGCGCATCGTGGAGCTGGCCCACCAGGGTGTGCGGCCC
TGTGACATCTCCCGGCAGCTGCGGGTCAGCCACGGCTGTGTCAGCAAAATCCTGGGCAGG
TACTACGAGACCGGCAGCATCAAGCCGGGTGTGATCGGTGGCTCCAAGCCCAAAGTGGCG
ACGCCCAAAGTGGTGGACAAGATTGCTGAATACAAACGACAGAACCCGACTATGTTCGCC
TGGGAGATTCGAGACCGGCTCCTGGCCGAGGGCATCTGTGACAATGACACAGTGCCCAGC
GTCTCTTCCATCAACAGAATCATCCGGACCAAAGTTCAGCAGCCTTTCCACCCAACGCCG
GATGGGGCTGGGACAGGAGTGACCGCCCCTGGCCACACCATTGTTCCCAGCACGGCCTCC
CCTCCTGTTTCCAGCGCCTCCAATGACCCAGTGGGATCCTACTCCATCAATGGGATCCTG
GGGATTCCTCGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGATGTGTCTGAGGGCTCA
GTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGAC
ACCTTCACCCAGCAGCAGCTGGAAGCTTTGGATCGGGTCTTTGAGCGTCCTTCCTACCCT
GACGTCTTCCAGGCATCAGAGCACATCAAATCAGAACAGGGGAACGAGTACTCCCTCCCA
GCCCTGACCCCTGGGCTTGATGAAGTCAAGTCGAGTCTATCTGCATCCACCAACCCTGAG
CTGGGCAGCAACGTGTCAGGCACACAGACATACCCAGTTGTGACTGGTCGTGACATGGCG
AGCACCACTCTGCCTGGTTACCCCCCTCACGTGCCCCCCACTGGCCAGGGAAGCTACCCC
ACCTCCACCCTGGCAGGAATGGTGCCTGAGGCTGCAGTTGGTCCCTCATCCTCCCTCATG
AGCAAGCCGGGGAGGAAGCTTGCAGAAGTGCCCCCTTGTGTGCAACCCACTGGAGCGAGT
TCTCCGGCAACCCGTACAGCCACCCCCAGTACACGGCCTACAACGAGGCTTGGAGATTCA
GCAACCCCGCCTTACTAAGTTCCCCTTATTATTATAGTGCCGCCCCCCGGTCCGCCCCTG
CCGCTGCTGCCGCTGCCTATGACCGCCACTAGTTAAGGGC
Restriction Sites Please inquire
ACCN NM_003988
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003988.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003988.2, NP_003979.2
RefSeq Size 4290 bp
RefSeq ORF 1191 bp
Locus ID 5076
UniProt ID Q02962
Cytogenetics 10q24.31
Protein Families Druggable Genome
Summary PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (c) has multiple differences in the coding region, compared to variant e, one of which results in a translational frameshift. The resulting protein (isoform c) has a distinct C-terminus and is shorter than isoform e. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:PAX2 (NM_003988) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218386 PAX2 (Myc-DDK-tagged)-Human paired box 2 (PAX2), transcript variant c 10 ug
$457.00
RC218386L3 Lenti ORF clone of Human paired box 2 (PAX2), transcript variant c, Myc-DDK-tagged 10 ug
$757.00
RC218386L4 Lenti ORF clone of Human paired box 2 (PAX2), transcript variant c, mGFP tagged 10 ug
$757.00
RG218386 PAX2 (tGFP-tagged) - Human paired box 2 (PAX2), transcript variant c 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.