PAX2 (NM_003988) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PAX2 |
Synonyms | FSGS7; PAPRS |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_003988 edited
CCTCCCTTTTCTCCTCAAGTCCTGAAGTTGAGTTTGAGAGGCGACACGGCGGCGGCGGCC GCGCTGCTCCCGCTCCTCTGCCTCCCCATGGATATGCACTGCAAAGCAGACCCCTTCTCC GCGATGCACCCAGGGCACGGGGGTGTGAACCAGCTCGGGGGGGTGTTTGTGAACGGCCGG CCCCTACCCGACGTGGTGAGGCAGCGCATCGTGGAGCTGGCCCACCAGGGTGTGCGGCCC TGTGACATCTCCCGGCAGCTGCGGGTCAGCCACGGCTGTGTCAGCAAAATCCTGGGCAGG TACTACGAGACCGGCAGCATCAAGCCGGGTGTGATCGGTGGCTCCAAGCCCAAAGTGGCG ACGCCCAAAGTGGTGGACAAGATTGCTGAATACAAACGACAGAACCCGACTATGTTCGCC TGGGAGATTCGAGACCGGCTCCTGGCCGAGGGCATCTGTGACAATGACACAGTGCCCAGC GTCTCTTCCATCAACAGAATCATCCGGACCAAAGTTCAGCAGCCTTTCCACCCAACGCCG GATGGGGCTGGGACAGGAGTGACCGCCCCTGGCCACACCATTGTTCCCAGCACGGCCTCC CCTCCTGTTTCCAGCGCCTCCAATGACCCAGTGGGATCCTACTCCATCAATGGGATCCTG GGGATTCCTCGCTCCAATGGTGAGAAGAGGAAACGTGATGAAGATGTGTCTGAGGGCTCA GTCCCCAATGGAGATTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACTTGCGAGCTGAC ACCTTCACCCAGCAGCAGCTGGAAGCTTTGGATCGGGTCTTTGAGCGTCCTTCCTACCCT GACGTCTTCCAGGCATCAGAGCACATCAAATCAGAACAGGGGAACGAGTACTCCCTCCCA GCCCTGACCCCTGGGCTTGATGAAGTCAAGTCGAGTCTATCTGCATCCACCAACCCTGAG CTGGGCAGCAACGTGTCAGGCACACAGACATACCCAGTTGTGACTGGTCGTGACATGGCG AGCACCACTCTGCCTGGTTACCCCCCTCACGTGCCCCCCACTGGCCAGGGAAGCTACCCC ACCTCCACCCTGGCAGGAATGGTGCCTGAGGCTGCAGTTGGTCCCTCATCCTCCCTCATG AGCAAGCCGGGGAGGAAGCTTGCAGAAGTGCCCCCTTGTGTGCAACCCACTGGAGCGAGT TCTCCGGCAACCCGTACAGCCACCCCCAGTACACGGCCTACAACGAGGCTTGGAGATTCA GCAACCCCGCCTTACTAAGTTCCCCTTATTATTATAGTGCCGCCCCCCGGTCCGCCCCTG CCGCTGCTGCCGCTGCCTATGACCGCCACTAGTTAAGGGC |
Restriction Sites | Please inquire |
ACCN | NM_003988 |
Insert Size | 1400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003988.2. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_003988.2, NP_003979.2 |
RefSeq Size | 4290 bp |
RefSeq ORF | 1191 bp |
Locus ID | 5076 |
UniProt ID | Q02962 |
Cytogenetics | 10q24.31 |
Protein Families | Druggable Genome |
Summary | PAX2 encodes paired box gene 2, one of many human homologues of the Drosophila melanogaster gene prd. The central feature of this transcription factor gene family is the conserved DNA-binding paired box domain. PAX2 is believed to be a target of transcriptional supression by the tumor suppressor gene WT1. Mutations within PAX2 have been shown to result in optic nerve colobomas and renal hypoplasia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (c) has multiple differences in the coding region, compared to variant e, one of which results in a translational frameshift. The resulting protein (isoform c) has a distinct C-terminus and is shorter than isoform e. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC218386 | PAX2 (Myc-DDK-tagged)-Human paired box 2 (PAX2), transcript variant c | 10 ug |
$457.00
|
|
RC218386L3 | Lenti ORF clone of Human paired box 2 (PAX2), transcript variant c, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC218386L4 | Lenti ORF clone of Human paired box 2 (PAX2), transcript variant c, mGFP tagged | 10 ug |
$757.00
|
|
RG218386 | PAX2 (tGFP-tagged) - Human paired box 2 (PAX2), transcript variant c | 10 ug |
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.