PLA2G10 (NM_003561) Human Untagged Clone
CAT#: SC303347
PLA2G10 (untagged)-Human phospholipase A2, group X (PLA2G10)
"NM_003561" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PLA2G10 |
Synonyms | GXPLA2; GXSPLA2; SPLA2; sPLA2-X |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303347 representing NM_003561.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGCCGCTACCTGTGTGCCTGCCAATCATGCTGCTCCTGCTACTGCCGTCGCTGCTGCTGCTGCTG CTTCTACCTGGCCCCGGGTCCGGCGAGGCCTCCAGGATATTACGTGTGCACCGGCGTGGGATCCTGGAA CTGGCAGGAACTGTGGGTTGTGTTGGTCCCCGAACCCCCATCGCCTATATGAAATATGGTTGCTTTTGT GGCTTGGGAGGCCATGGCCAGCCCCGCGATGCCATTGACTGGTGCTGCCATGGCCACGACTGTTGTTAC ACTCGAGCTGAGGAGGCCGGCTGCAGCCCCAAGACAGAGCGCTACTCCTGGCAGTGCGTCAATCAGAGC GTCCTGTGCGGACCGGCAGAGAACAAATGCCAAGAACTGTTGTGCAAGTGTGACCAGGAGATTGCTAAC TGCTTAGCCCAAACTGAGTACAACTTAAAGTACCTCTTCTACCCCCAGTTCCTATGTGAGCCGGACTCG CCCAAGTGTGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_003561 |
Insert Size | 498 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_003561.2 |
RefSeq Size | 924 bp |
RefSeq ORF | 498 bp |
Locus ID | 8399 |
UniProt ID | O15496 |
Cytogenetics | 16p13.12 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway |
MW | 18.2 kDa |
Gene Summary | This gene encodes a member of the phospholipase A2 family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature enzyme. This calcium-dependent enzyme hydrolyzes glycerophospholipids to produce free fatty acids and lysophospholipids. In one example, this enzyme catalyzes the release of arachidonic acid from cell membrane phospholipids, thus playing a role in the production of various inflammatory lipid mediators, such as prostaglandins. The encoded protein may promote the survival of breast cancer cells through its role in lipid metabolism. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (1) represents the protein-coding transcript. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213014 | PLA2G10 (Myc-DDK-tagged)-Human phospholipase A2, group X (PLA2G10) |
USD 150.00 |
|
RC213014L1 | Lenti ORF clone of Human phospholipase A2, group X (PLA2G10), Myc-DDK-tagged |
USD 450.00 |
|
RC213014L2 | Lenti ORF clone of Human phospholipase A2, group X (PLA2G10), mGFP tagged |
USD 450.00 |
|
RC213014L3 | Lenti ORF clone of Human phospholipase A2, group X (PLA2G10), Myc-DDK-tagged |
USD 450.00 |
|
RC213014L4 | Lenti ORF clone of Human phospholipase A2, group X (PLA2G10), mGFP tagged |
USD 450.00 |
|
RG213014 | PLA2G10 (tGFP-tagged) - Human phospholipase A2, group X (PLA2G10) |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review