PLA2G10 (NM_003561) Human Untagged Clone

SKU
SC303347
PLA2G10 (untagged)-Human phospholipase A2, group X (PLA2G10)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PLA2G10
Synonyms GXPLA2; GXSPLA2; SPLA2; sPLA2-X
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303347 representing NM_003561.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGCCGCTACCTGTGTGCCTGCCAATCATGCTGCTCCTGCTACTGCCGTCGCTGCTGCTGCTGCTG
CTTCTACCTGGCCCCGGGTCCGGCGAGGCCTCCAGGATATTACGTGTGCACCGGCGTGGGATCCTGGAA
CTGGCAGGAACTGTGGGTTGTGTTGGTCCCCGAACCCCCATCGCCTATATGAAATATGGTTGCTTTTGT
GGCTTGGGAGGCCATGGCCAGCCCCGCGATGCCATTGACTGGTGCTGCCATGGCCACGACTGTTGTTAC
ACTCGAGCTGAGGAGGCCGGCTGCAGCCCCAAGACAGAGCGCTACTCCTGGCAGTGCGTCAATCAGAGC
GTCCTGTGCGGACCGGCAGAGAACAAATGCCAAGAACTGTTGTGCAAGTGTGACCAGGAGATTGCTAAC
TGCTTAGCCCAAACTGAGTACAACTTAAAGTACCTCTTCTACCCCCAGTTCCTATGTGAGCCGGACTCG
CCCAAGTGTGACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_003561
Insert Size 498 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003561.2
RefSeq Size 924 bp
RefSeq ORF 498 bp
Locus ID 8399
UniProt ID O15496
Cytogenetics 16p13.12
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway
MW 18.2 kDa
Summary This gene encodes a member of the phospholipase A2 family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature enzyme. This calcium-dependent enzyme hydrolyzes glycerophospholipids to produce free fatty acids and lysophospholipids. In one example, this enzyme catalyzes the release of arachidonic acid from cell membrane phospholipids, thus playing a role in the production of various inflammatory lipid mediators, such as prostaglandins. The encoded protein may promote the survival of breast cancer cells through its role in lipid metabolism. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (1) represents the protein-coding transcript.
Write Your Own Review
You're reviewing:PLA2G10 (NM_003561) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213014 PLA2G10 (Myc-DDK-tagged)-Human phospholipase A2, group X (PLA2G10) 10 ug
$150.00
RC213014L1 Lenti ORF clone of Human phospholipase A2, group X (PLA2G10), Myc-DDK-tagged 10 ug
$450.00
RC213014L2 Lenti ORF clone of Human phospholipase A2, group X (PLA2G10), mGFP tagged 10 ug
$450.00
RC213014L3 Lenti ORF clone of Human phospholipase A2, group X (PLA2G10), Myc-DDK-tagged 10 ug
$450.00
RC213014L4 Lenti ORF clone of Human phospholipase A2, group X (PLA2G10), mGFP tagged 10 ug
$450.00
RG213014 PLA2G10 (tGFP-tagged) - Human phospholipase A2, group X (PLA2G10) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.