IFNW1 (NM_002177) Human Untagged Clone

SKU
SC303138
IFNW1 (untagged)-Human interferon, omega 1 (IFNW1)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IFNW1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002177 edited
TCCCAGCTCAGTAAAGCCAGGAGCATCCTCATTTCCCAATGGCCCTCCTGTTCCCTCTAC
TGGCAGCCCTAGTGATGACCAGCTATAGCCCTGTTGGATCTCTGGGCTGTGATCTGCCTC
AGAACCATGGCCTACTTAGCAGGAACACCTTGGTGCTTCTGCACCAAATGAGGAGAATCT
CCCCTTTCTTGTGTCTCAAGGACAGAAGAGACTTCAGGTTCCCCCAGGAGATGGTAAAAG
GGAGCCAGTTGCAGAAGGCCCATGTCATGTCTGTCCTCCATGAGATGCTGCAGCAGATCT
TCAGCCTCTTCCACACAGAGCGCTCCTCTGCTGCCTGGAACATGACCCTCCTAGACCAAC
TCCACACTGGACTTCATCAGCAACTGCAACACCTGGAGACCTGCTTGCTGCAGGTAGTGG
GAGAAGGAGAATCTGCTGGGGCAATTAGCAGCCCTGCACTGACCTTGAGGAGGTACTTCC
AGGGAATCCGTGTCTACCTGAAAGAGAAGAAATACAGCGACTGTGCCTGGGAAGTTGTCA
GAATGGAAATCATGAAATCCTTGTTCTTATCAACAAACATGCAAGAAAGACTGAGAAGTA
AAGATAGAGACCTGGGCTCATCTTGAAATGATTCTCATTGATTAATTTGCCATATAACAC
TTGCACATGTGACTCTGGTCAATTCAAAAGACTCTTATTTCGGCTTTAATCACAGAATTG
ACTGAATTAGTTCTGCAAATACTTTGTCGGTATATTAAGCCAGTATATGTTAAAAAGACT
TAGGTTCAGGGGCATCAGTCC
Restriction Sites Please inquire
ACCN NM_002177
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002177.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002177.1, NP_002168.1
RefSeq Size 1514 bp
RefSeq ORF 588 bp
Locus ID 3467
UniProt ID P05000
Cytogenetics 9p21.3
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, RIG-I-like receptor signaling pathway
Summary The protein encoded by this gene is an interferon and possesses antiviral activity. The encoded protein binds to the interferon alpha/beta receptor but not to the interferon gamma receptor. This intronless gene has several pseudogenes spread throughout the genome. [provided by RefSeq, Nov 2015]
Write Your Own Review
You're reviewing:IFNW1 (NM_002177) Human Untagged Clone
Your Rating
SKU Description Size Price
RC222484 IFNW1 (Myc-DDK-tagged)-Human interferon, omega 1 (IFNW1) 10 ug
$300.00
RC222484L1 Lenti ORF clone of Human interferon, omega 1 (IFNW1), Myc-DDK-tagged 10 ug
$600.00
RC222484L2 Lenti ORF clone of Human interferon, omega 1 (IFNW1), mGFP tagged 10 ug
$600.00
RC222484L3 Lenti ORF clone of Human interferon, omega 1 (IFNW1), Myc-DDK-tagged 10 ug
$600.00
RC222484L4 Lenti ORF clone of Human interferon, omega 1 (IFNW1), mGFP tagged 10 ug
$600.00
RG222484 IFNW1 (tGFP-tagged) - Human interferon, omega 1 (IFNW1) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.