Interferon alpha10 (IFNA10) (NM_002171) Human Untagged Clone
CAT#: SC303134
IFNA10 (untagged)-Human interferon, alpha 10 (IFNA10)
"NM_002171" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | Interferon alpha10 |
Synonyms | IFN-alphaC |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303134 representing NM_002171.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCCTGTCCTTTTCTTTACTTATGGCCGTGCTGGTGCTCAGCTACAAATCCATCTGTTCTCTAGGC TGTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGGCCTTGATACTCCTGGGACAAATGGGAAGA ATCTCTCCTTTCTCCTGCCTGAAGGACAGACATGATTTCCGAATCCCCCAGGAGGAGTTTGATGGCAAC CAGTTCCAGAAGGCTCAAGCCATCTCTGTCCTCCATGAGATGATCCAGCAGACCTTCAATCTCTTCAGC ACAGAGGACTCATCTGCTGCTTGGGAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTTACCAGCAA CTGAATGACCTGGAAGCATGTGTGATACAGGAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGAGGAC TCCATCCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTTTATCTAATAGAGAGGAAATACAGCCCT TGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCCTCTCGTTTTCAACAAACTTGCAAAAAAGA TTAAGGAGGAAGGATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_002171 |
Insert Size | 570 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002171.2 |
RefSeq Size | 963 bp |
RefSeq ORF | 570 bp |
Locus ID | 3446 |
UniProt ID | P01566 |
Cytogenetics | 9p21.3 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Antigen processing and presentation, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Regulation of autophagy, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway |
MW | 21.8 kDa |
Gene Summary | This gene encodes a protein that belongs to the type I interferon family of proteins, and is located in a cluster of alpha interferon genes on chromosome 9. Interferons are small regulatory molecules that function in cell signaling in response to viruses and other pathogens or tumor cells. This gene is intronless and the encoded protein is secreted. [provided by RefSeq, Aug 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214055 | IFNA10 (Myc-DDK-tagged)-Human interferon, alpha 10 (IFNA10) |
USD 300.00 |
|
RC214055L1 | Lenti ORF clone of Human interferon, alpha 10 (IFNA10), Myc-DDK-tagged |
USD 600.00 |
|
RC214055L2 | Lenti ORF clone of Human interferon, alpha 10 (IFNA10), mGFP tagged |
USD 600.00 |
|
RC214055L3 | Lenti ORF clone of Human interferon, alpha 10 (IFNA10), Myc-DDK-tagged |
USD 600.00 |
|
RC214055L4 | Lenti ORF clone of Human interferon, alpha 10 (IFNA10), mGFP tagged |
USD 600.00 |
|
RG214055 | IFNA10 (tGFP-tagged) - Human interferon, alpha 10 (IFNA10) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review