GALR1 (NM_001480) Human Untagged Clone

SKU
SC303029
GALR1 (untagged)-Human galanin receptor 1 (GALR1)
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GALR1
Synonyms GALNR; GALNR1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001480 edited
ATGGAGCTGGCGGTCGGGAACCTCAGCGAGGGCAACGCGAGCTGGCCGGAGCCCCCCGCC
CCGGAGCCCGGGCCGCTGTTCGGCATCGGCGTGGAGAACTTCGTCACGCTGGTGGTGTTC
GGCCTGATCTTCGCGCTGGGCGTGCTGGGCAACAGCCTAGTGATCACCGTGCTGGCGCGC
AGCAAGCCGGGCAAGCCGCGGAGCACCACCAACCTGTTCATCCTCAACCTGAGCATCGCC
GACCTGGCCTACCTGCTCTTCTGCATCCCCTTCCAGGCCACCGTGTACGCGCTGCCCACC
TGGGTGCTGGGCGCCTTCATCTGCAAGTTCATCCACTACTTCTTCACCGTGTCCATGCTG
GTGAGCATCTTCACCCTGGCCGCGATGTCCGTGGACCGCTACGTGGCCATCGTGCACTCG
CGGCGCTCCTCCTCCCTCAGGGTGTCCCGCAACGCGCTGCTGGGCGTGGGCTGCATCTGG
GCGCTGTCCATTGCCATGGCCTCGCCCGTGGCCTACCACCAGGGCCTCTTCCACCCGCGC
GCCAGCAACCAGACCTTCTGCTGGGAGCAGTGGCCCGACCCTCGCCACAAGAAGGCCTAC
GTGGTGTGCACCTTCGTCTTCGGCTACCTGCTGCCGCTCCTGCTCATCTGCTTCTGCTAT
GCCAAGGTCCTTAATCACTTGCATAAAAAGTTGAAGAACATGTCAAAGAAGTCTGAAGCA
TCCAAGAAAAAGACTGCACAGACAGTTCTGGTGGTGGTTGTGGTGTTTGGAATCTCCTGG
CTGCCGCACCACATCATCCATCTCTGGGCTGAGTTTGGAGTTTTCCCGCTGACGCCGGCT
TCCTTCCTCTTCAGAATCACCGCCCACTGCCTGGCGTACAGCAATTCCTCCGTGAATCCT
ATCATTTATGCATTTCTCTCTGAAAATTTCAGGAAGGCCTATAAACAAGTGTTCAAGTGT
CACATTCGCAAAGATTCACACCTGAGTGATACTAAAGAAAATAAAAGTCGAATAGACACC
CCACCATCAACCAATTGTACTCATGTGTGA
Restriction Sites Please inquire
ACCN NM_001480
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001480.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001480.2, NP_001471.1
RefSeq Size 3056 bp
RefSeq ORF 1050 bp
Locus ID 2587
UniProt ID P47211
Cytogenetics 18q23
Protein Families Druggable Genome, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Summary The neuropeptide galanin elicits a range of biological effects by interaction with specific G-protein-coupled receptors. Galanin receptors are seven-transmembrane proteins shown to activate a variety of intracellular second-messenger pathways. GALR1 inhibits adenylyl cyclase via a G protein of the Gi/Go family. GALR1 is widely expressed in the brain and spinal cord, as well as in peripheral sites such as the small intestine and heart. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:GALR1 (NM_001480) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213471 GALR1 (Myc-DDK-tagged)-Human galanin receptor 1 (GALR1) 10 ug
$457.00
RC213471L3 Lenti ORF clone of Human galanin receptor 1 (GALR1), Myc-DDK-tagged 10 ug
$757.00
RC213471L4 Lenti ORF clone of Human galanin receptor 1 (GALR1), mGFP tagged 10 ug
$757.00
RG213471 GALR1 (tGFP-tagged) - Human galanin receptor 1 (GALR1) 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.