SRA1 (NM_001035235) Human Untagged Clone

SKU
SC302827
SRA1 (untagged)-Human steroid receptor RNA activator 1 (SRA1)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SRA1
Synonyms pp7684; SRA; SRAP; STRAA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC302827 representing NM_001035235.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACGCGCTGCCCCGCTGGCCAAGCGGAAGTGGAGATGGCGGAGCTGTACGTGAAGCCGGGCAACAAG
GAACGCGGCTGGAACGACCCGCCGCAGTTCTCATACGGGCTGCAGACCCAGGCCGGCGGACCCAGGCGC
TCGCTGCTTACCAAGAGGGTCGCCGCACCCCAGGATGGATCCCCCAGAGTCCCCGCATCAGAGACTTCT
CCTGGGCCTCCCCCAATGGGGCCTCCACCTCCTTCAAGTAAGGCTCCCAGGTCCCCACCTGTGGGGAGT
GGTCCTGCCTCTGGCGTGGAGCCCACAAGTTTCCCAGTCGAGTCTGAGGCTGTGATGGAGGATGTGCTG
AGACCTTTGGAACAGGCATTGGAAGACTGCCGTGGCCACACAAGGAAGCAGGTATGTGATGACATCAGC
CGACGCCTGGCACTGCTGCAGGAACAGTGGGCTGGAGGAAAGTTGTCAATACCTGTAAAGAAGAGAATG
GCTCTACTGGTGCAAGAGCTTTCAAGCCACCGGTGGGACGCAGCAGATGACATCCACCGCTCCCTCATG
GTTGACCATGTGACTGAGGTCAGTCAGTGGATGGTAGGAGTTAAAAGATTAATTGCAGAAAAGAGGAGT
CTGTTTTCAGAGGAGGCAGCCAATGAAGAGAAATCTGCAGCCACAGCTGAGAAGAACCATACCATACCA
GGCTTCCAGCAGGCTTCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001035235
Insert Size 711 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001035235.3
RefSeq Size 1955 bp
RefSeq ORF 711 bp
Locus ID 10011
UniProt ID Q9HD15
Cytogenetics 5q31.3
MW 25.7 kDa
Summary Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (1) encodes the longer isoform (1).
Write Your Own Review
You're reviewing:SRA1 (NM_001035235) Human Untagged Clone
Your Rating
SKU Description Size Price
RC220899 SRA1 (Myc-DDK-tagged)-Human steroid receptor RNA activator 1 (SRA1) 10 ug
$618.00
RC220899L1 Lenti ORF clone of Human steroid receptor RNA activator 1 (SRA1), Myc-DDK-tagged 10 ug
$918.00
RC220899L2 Lenti ORF clone of Human steroid receptor RNA activator 1 (SRA1), mGFP tagged 10 ug
$918.00
RC220899L3 Lenti ORF clone of Human steroid receptor RNA activator 1 (SRA1), Myc-DDK-tagged 10 ug
$918.00
RC220899L4 Lenti ORF clone of Human steroid receptor RNA activator 1 (SRA1), mGFP tagged 10 ug
$918.00
RG220899 SRA1 (tGFP-tagged) - Human steroid receptor RNA activator 1 (SRA1) 10 ug
$818.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.