PQBP1 (NM_001032384) Human Untagged Clone

SKU
SC302649
PQBP1 (untagged)-Human polyglutamine binding protein 1 (PQBP1), transcript variant 5
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PQBP1
Synonyms MRX2; MRX55; MRXS3; MRXS8; NPW38; RENS1; SHS
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001032384, the custom clone sequence may differ by one or more nucleotides
ATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTG
GAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACTAC
GAGGCCACCAGGTTGGAGGGCCTACCACCAAGCTGGTACAAGGTGTTCGACCCTTCCTGC
GGGCTCCCTTACTACTGGAATGCAGACACAGACCTTGTATCCTGGCTCTCCCCACATGAC
CCCAACTCCGTGGTTACCAAATCGGCCAAGAAGCTCAGAAGCAGTAATGCAGATGCTGAA
GAAAAGTTGGACCGGAGCCATGACAAGTCGGACAGGGGCCATGACAAGTCGGACCGCAGC
CATGAGAAACTAGACAGGGGCCACGACAAGTCAGACCGGGGCCACGACAAGTCTGACAGG
GATCGAGAGCGTGGCTATGACAAGGTAGACAGAGAGAGAGAGCGAGACAGGGAACGGGAT
CGGGACCGCGGGTATGACAAGGCAGACCGGGAAGAGGGCAAAGAACGGCGCCACCATCGC
CGGGAGGAGCTGGCTCCCTATCCCAAGAGCAAGAAGGCAGTAAGCCGAAAGGATGAAGAG
TTAGACCCCATGGACCCTAGCTCATACTCAGACGCCCCCCGGGGCACGTGGTCAACAGGA
CTCCCCAAGCGGAATGAGGCCAAGACTGGCGCTGACACCACAGCAGCTGGGCCCCTCTTC
CAGCAGCGGCCGTATCCATCCCCAGGGGCTGTGCTCCGGGCCAATGCAGAGGCCTCCCGA
ACCAAGCAGCAGGATTGA
Restriction Sites Please inquire
ACCN NM_001032384
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001032384.1, NP_001027556.1
RefSeq Size 1002 bp
RefSeq ORF 798 bp
Locus ID 10084
UniProt ID O60828
Cytogenetics Xp11.23
Protein Families Transcription Factors
Protein Pathways Spliceosome
Summary This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked cognitive disability. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]
Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein (isoform 1).
Write Your Own Review
You're reviewing:PQBP1 (NM_001032384) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221161 PQBP1 (Myc-DDK-tagged)-Human polyglutamine binding protein 1 (PQBP1), transcript variant 5 10 ug
$300.00
RC221161L3 Lenti-ORF clone of PQBP1 (Myc-DDK-tagged)-Human polyglutamine binding protein 1 (PQBP1), transcript variant 5 10 ug
$600.00
RC221161L4 Lenti-ORF clone of PQBP1 (mGFP-tagged)-Human polyglutamine binding protein 1 (PQBP1), transcript variant 5 10 ug
$600.00
RG221161 PQBP1 (tGFP-tagged) - Human polyglutamine binding protein 1 (PQBP1), transcript variant 5 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.