HNF 4 alpha (HNF4A) (NM_001030004) Human Untagged Clone

SKU
SC302486
HNF4A (untagged)-Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 6
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HNF 4 alpha
Synonyms FRTS4; HNF4; HNF4a7; HNF4a8; HNF4a9; HNF4alpha; MODY; MODY1; NR2A1; NR2A21; TCF; TCF-14; TCF14
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001030004 edited
ATGGTCAGCGTGAACGCGCCCCTCGGGGCTCCAGTGGAGAGTTCTTACGACACGTCCCCA
TCAGAAGGCACCAACCTCAACGCGCCCAACAGCCTGGGTGTCAGCGCCCTGTGTGCCATC
TGCGGGGACCGGGCCACGGGCAAACACTACGGTGCCTCGAGCTGTGACGGCTGCAAGGGC
TTCTTCCGGAGGAGCGTGCGGAAGAACCACATGTACTCCTGCAGATTTAGCCGGCAGTGC
GTGGTGGACAAAGACAAGAGGAACCAGTGCCGCTACTGCAGGCTCAAGAAATGCTTCCGG
GCTGGCATGAAGAAGGAAGCCGTCCAGAATGAGCGGGACCGGATCAGCACTCGAAGGTCA
AGCTATGAGGACAGCAGCCTGCCCTCCATCAATGCGCTCCTGCAGGCGGAGGTCCTGTCC
CGACAGATCACCTCCCCCGTCTCCGGGATCAACGGCGACATTCGGGCGAAGAAGATTGCC
AGCATCGCAGATGTGTGTGAGTCCATGAAGGAGCAGCTGCTGGTTCTCGTTGAGTGGGCC
AAGTACATCCCAGCTTTCTGCGAGCTCCCCCTGGACGACCAGGTGGCCCTGCTCAGAGCC
CATGCTGGCGAGCACCTGCTGCTCGGAGCCACCAAGAGATCCATGGTGTTCAAGGACGTG
CTGCTCCTAGGCAATGACTACATTGTCCCTCGGCACTGCCCGGAGCTGGCGGAGATGAGC
CGGGTGTCCATACGCATCCTTGACGAGCTGGTGCTGCCCTTCCAGGAGCTGCAGATCGAT
GACAATGAGTATGCCTACCTCAAAGCCATCATCTTCTTTGACCCAGATGCCAAGGGGCTG
AGCGATCCAGGGAAGATCAAGCGGCTGCGTTCCCAGGTGCAGGTGAGCTTGGAGGACTAC
ATCAACGACCGCCAGTATGACTCGCGTGGCCGCTTTGGAGAGCTGCTGCTGCTGCTGCCC
ACCTTGCAGAGCATCACCTGGCAGATGATCGAGCAGATCCAGTTCATCAAGCTCTTCGGC
ATGGCCAAGATTGACAACCTGTTGCAGGAGATGCTGCTGGGAGGTCCGTGCCAAGCCCAG
GAGGGGCGGGGTTGGAGTGGGGACTCCCCAGGAGACAGGCCTCACACAGTGAGCTCACCC
CTCAGCTCCTTGGCTTCCCCACTGTGCCGCTTTGGGCAAGTTGCTTAA
Restriction Sites Please inquire
ACCN NM_001030004
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001030004.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001030004.1, NP_001025175.1
RefSeq Size 1192 bp
RefSeq ORF 1188 bp
Locus ID 3172
UniProt ID P41235
Cytogenetics 20q13.12
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Nuclear Hormone Receptor, Transcription Factors
Protein Pathways Maturity onset diabetes of the young
Summary The protein encoded by this gene is a nuclear transcription factor which binds DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor which regulates the expression of several hepatic genes. This gene may play a role in development of the liver, kidney, and intestines. Mutations in this gene have been associated with monogenic autosomal dominant non-insulin-dependent diabetes mellitus type I. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (6) contains an alternate 5' terminal exon (resulting in translation initiation from an alternate upstream start codon) and differs at the 3' end that causes a frame-shift compared to variant 2. The resulting shorter isoform (6, also known as HNF4alpha9) has distinct N- and C-termini compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:HNF 4 alpha (HNF4A) (NM_001030004) Human Untagged Clone
Your Rating
SKU Description Size Price
RC216588 HNF4A (Myc-DDK-tagged)-Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 6 10 ug
$457.00
RC216588L1 Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 6, Myc-DDK-tagged 10 ug
$757.00
RC216588L2 Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 6, mGFP tagged 10 ug
$757.00
RC216588L3 Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 6, Myc-DDK-tagged 10 ug
$757.00
RC216588L4 Lenti ORF clone of Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 6, mGFP tagged 10 ug
$757.00
RG216588 HNF4A (tGFP-tagged) - Human hepatocyte nuclear factor 4, alpha (HNF4A), transcript variant 6 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.