VEGFA (NM_001025366) Human Untagged Clone

CAT#: SC302394

VEGFA (untagged)-Human vascular endothelial growth factor A (VEGFA), transcript variant 1

USD 660.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name VEGFA (NM_001025366) Human Untagged Clone
Symbol VEGFA
Synonyms MVCD1; VEGF; VPF
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001025366 edited
CGTGGCGCTGGGGGCTAGCACCAGCGCTCTGTCGGGAGGCGCAGCGGTTAGGTGGACCGG
TCAGCGGACTCACCGGCCAGGGCGCTCGGTGCTGGAATTTGATATTCATTGATCCGGGTT
TTATCCCTCTTCTTTTTTCTTAAACATTTTTTTTTAAAACTGTATTGTTTCTCGTTTTAA
TTTATTTTTGCTTGCCATTCCCCACTTGAATCGGGCCGACGGCTTGGGGAGATTGCTCTA
CTTCCCCAAATCACTGTGGATTTTGGAAACCAGCAGAAAGAGGAAAGAGGTAGCAAGAGC
TCCAGAGAGAAGTCGAGGAAGAGAGAGACGGGGTCAGAGAGAGCGCGCGGGCGTGCGAGC
AGCGAAAGGGACAGGGGCAAAGTGAGTGACCTGCTTTTGGGGGTGACCGCCGGAGCGCGG
CGTGAGCCCTCCCCCTTGGGATCCCGCAGCTGACCAGTCGCGCTGACGGACAGACAGACA
GACACCGCCCCCAGCCCCAGCTACCACCTCCTCCCCGGCCGGCGGCGGACAGTGGACGCG
GCGGCGAGCCGCGGGCAGGGGCCGGAGCCCGCGCCCGGAGGCGGGGTGGAGGGGGTCGGG
GCTCGCGGCGTCGCACTGAAACTTTTCGTCCAACTTCTGGGCTGTTCTCGCTTCGGAGGA
GCCGTGGTCCGCGCGGGGGAAGCCGAGCCGAGCGGAGCCGCGAGAAGTGCTAGCTCGGGC
CGGGAGGAGCCGCAGCCGGAGGAGGGGGAGGAGGAAGAAGAGAAGGAAGAGGAGAGGGGG
CCGCAGTGGCGACTCGGCGCTCGGAAGCCGGGCTCATGGACGGGTGAGGCGGCGGTGTGC
GCAGACAGTGCTCCAGCCGCGCGCGCTCCCCAGGCCCTGGCCCGGGCCTCGGGCCGGGGA
GGAAGAGTAGCTCGCCGAGGCGCCGAGGAGAGCGGGCCGCCCCACAGCCCGAGCCGGAGA
GGGAGCGCGAGCCGCGCCGGCCCCGGTCGGGCCTCCGAAACCATGAACTTTCTGCTGTCT
TGGGTGCATTGGAGCCTTGCCTTGCTGCTCTACCTCCACCATGCCAAGTGGTCCCAGGCT
GCACCCATGGCAGAAGGAGGAGGGCAGAATCATCACGAAGTGGTGAAGTTCATGGATGTC
TATCAGCGCAGCTACTGCCATCCAATCGAGACCCTGGTGGACATCTTCCAGGAGTACCCT
GATGAGATCGAGTACATCTTCAAGCCATCCTGTGTGCCCCTGATGCGATGCGGGGGCTGC
TGCAATGACGAGGGCCTGGAGTGTGTGCCCACTGAGGAGTCCAACATCACCATGCAGATT
ATGCGGATCAAACCTCACCAAGGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAAC
AAATGTGAATGCAGACCAAAGAAAGATAGAGCAAGACAAGAAAAAAAATCAGTTCGAGGA
AAGGGAAAGGGGCAAAAACGAAAGCGCAAGAAATCCCGGTATAAGTCCTGGAGCGTGTAC
GTTGGTGCCCGCTGCTGTCTAATGCCCTGGAGCCTCCCTGGCCCCCATCCCTGTGGGCCT
TGCTCAGAGCGGAGAAAGCATTTGTTTGTACAAGATCCGCAGACGTGTAAATGTTCCTGC
AAAAACACAGACTCGCGTTGCAAGGCGAGGCAGCTTGAGTTAAACGAACGTACTTGCAGA
TGTGACAAGCCGAGGCGGTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001025366 unedited
NNGGCGCGGTTCACATTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACCAGCAG
CCGGGTAGCTCGNGAGTCGTGGCGCTGGGGGCTAGCACCAGCGCTCTGTCGGGAGGCGCA
GCGGTTAGGTGGACCGGTCAGCGGACTCACCGGCCAGGGCGCTCGGTGCTGGAATTTGAT
ATTCATTGATCCGGGTTTTATCCCTCTTCTTTTTTCTTAAACATTTTTTTTTAAAACTGT
ATTGTTTCTCGTTTTAATTTATTTTTGCTTGCCATTCCCCACTTGAATCGGGCCGACGGC
TTGGGGAGATTGCTCTACTTCCCCAAATCACTGTGGATTTTGGAAACCAGCAGAAAGAGG
AAAGAGGTAGCAAGAGCTCCAGAGAGAAGTCGAGGAAGAGAGAGACGGGGTCAGAGAGAG
CGCGCGGGCGTGCGAGCAGCGAAAGGGACAGGGGCAAAGTGAGTGACCTGCTTTTGGGGG
TGACCGCCGGAGCGCGGCGTGAGCCCTCCCCCTTGGGATCCCGCAGCTGACCAGTCGCGC
TGACGGACAGACAGACAGACACCGCCCCCAGCCCCAGCTACCACCTCCTCCCCGGCCGGC
GGCGGACAGTGGACGCGGCGGCGAGCCGCGGGCAGGGGCCGGAGCCCGCGCCCGGAGGCG
GGGTGGAGGGGGTCGGGGCTCGCGGCGTCGCACTGAAACTTTTCGTCCAACTTCTGGGCT
GTTCTCGCTTCGGAGGAGCCGTGGTCCGCGCGGGGGAAGCCGAGCCGAGCGGAGCCGCGA
GGAGTGCTAGCTCGGGCCGGGAGGAGCCCGCACCGGAGAGGGGGAGGAGGAAGAAGAGAA
GTAGAGGAGAGGGGGCCGCANTGGCGACTCGGCGCTGGGAGCCGGGCT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001025366 unedited
GGGCCATGGGATGGCAACTTCCAGGNCCAGNANAGCACTGGGGNGGGGTCACAGGGATGC
CACCCGGGATCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGCTACAGGAATCC
CAGAAATAAAACTCTCTAATCTTCCGGGCTCGGTGATTTAGCAGCAAGAAAAATAAAATG
GCGAATCCAATTCCAAGAGGGACCGTGCTGGGTCACCCGCCCGGGAATGCTTCCGCCGGA
GTCTCGCCCTCCGGACCCAAAGTGCTCTGCGCAGAGTCTCCTCTTCCTTCATTTCAGGTT
TCTGGATTAAGGACTGTTCTGTCGATGGTGATGGTGTGGTGGCGGCAGCGTGGTTTCTGT
ATCGATCGTTCTGTATCAGTCTTTCCTGGTGAGAGATCTGGTTCCCGAAACCCTGAGGGA
GGCTCCTTCCTCCTGCCCGGCTCACCGCCTCGGCTTGTCACATCTGCAAGTACGTTCGTT
TAACTCAAGCTGCCTCGCCTTGCAACGCGAGTCTGTGTTTTTGCAGGAACATTTACACGT
CTGCGGATCTTGTACAAACAAATGCTTTCTCCGCTCTGAGCAAGGCCCACAGGGATGGGG
GCCAGGGAGGCTCCAGGGCATTAGACAGCAGCGGGCACCAACGTACACGCTCCAGGACTT
ATACCGGGATTTCTTGCGCTTTCGTTTTTGCCCCTTTCCCTTTCCTCGAACTGATTTTTT
TTCTTGTCTTGCTCTATCTTTCTTTGGTCTGCATTCACATTTGTTGTGCTGTANGAAGCT
CATCTCTCCTATGTGCTGGCCTTGGTGAGGTTTGATCCGCATAATCTGCATGGTGATGTT
GGACTCCTCAGTGGGCACACACTCCCAGGCCCTCGTCATTGCAGCAGCCCCCGCATCGCA
T
Tag Tag Free
ACCN NM_001025366
ORF Size 1239 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation There are no nucleotide differences between the OriGene clone and the NCBI reference ORF. Please note the alternative use of CTG as the initiation codon. A protein BLAST will incorrectly interpret this codon as coding for a leucine residue.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001025366.1, NP_001020537
RefSeq Size 3665
Locus ID 7422
Cytogenetics 6p21.1
Protein Families Secreted Protein, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, mTOR signaling pathway, VEGF signaling pathway, Focal adhesion, Pathways in cancer, Renal cell carcinoma, Pancreatic cancer, Bladder cancer
Gene Summary This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Elevated levels of this protein are found in patients with POEMS syndrome, also known as Crow-Fukase syndrome. Allelic variants of this gene have been associated with microvascular complications of diabetes 1 (MVCD1) and atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been described. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site. [provided by RefSeq, Nov 2015].
Transcript Variant: This variant (1) represents the longest transcript. This variant can initiate translation from four non-AUG (CUG) sites, and also from a downstream, in-frame AUG. The isoform (a) represented in this RefSeq is derived from the 5'-most CUG start codon. This is the longest isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations