Cytochrome P450 2D6 (CYP2D6) (NM_001025161) Human Untagged Clone

SKU
SC302357
CYP2D6 (untagged)-Human cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6), transcript variant 2
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Cytochrome P450 2D6
Synonyms CPD6; CYP2D; CYP2D7AP; CYP2D7BP; CYP2D7P2; CYP2D8P2; CYP2DL1; CYPIID6; P450-DB1; P450C2D; P450DB1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001025161 edited
ATGGGGCTAGAAGCACTGGTGCCCCTGGCCATGATAGTGGCCATCTTCCTGCTCCTGGTG
GACCTGATGCACCGGCGCCAACGCTGGGCTGCACGCTACCCACCAGGCCCCCTGCCACTG
CCCGGGCTGGGCAACCTGCTGCATGTGGACTTCCAGAACACACCATACTGCTTCGACCAG
TTGCGGCGCCGCTTCGGGGACGTGTTCAGCCTGCAGCTGGCCTGGACGCCGGTGGTCGTG
CTCAATGGGCTGGCGGCCGTGCGCGAGGCGCTGGTGACCCACGGCGAGGACACCGCCGAC
CGCCCGCCTGTGCCCATCACCCAGATCCTGGGTTTCGGGCCGCGTTCCCAAGGACGCCCC
TTTCGCCCCAACGGTCTCTTGGACAAAGCCGTGAGCAACGTGATCGCCTCCCTCACCTGC
GGGCGCCGCTTCGAGTACGACGACCCTCGCTTCCTCAGGCTGCTGGACCTAGCTCAGGAG
GGACTGAAGGAGGAGTCGGGCTTTCTGCGCGAGGTGCTGAATGCTGTCCCCGTCCTCCTG
CATATCCCAGCGCTGGCTGGCAAGGTCCTACGCTTCCAAAAGGCTTTCCTGACCCAGCTG
GATGAGCTGCTAACTGAGCACAGGATGACCTGGGACCCAGCCCAGCCCCCCCGAGACCTG
ACTGAGGCCTTCCTGGCAGAGATGGAGAAGGCCAAGGGGAACCCTGAGAGCAGCTTCAAT
GATGAGAACCTGTGCATAGTGGTGGCTGACCTGTTCTCTGCCGGGATGGTGACCACCTCG
ACCACGCTGGCCTGGGGCCTCCTGCTCATGATCCTACATCCGGATGTGCAGCGCCGTGTC
CAACAGGAGATCGACGACGTGATAGGGCAGGTGCGGCGACCAGAGATGGGTGACCAGGCT
CACATGCCCTACACCACTGCCGTGATTCATGAGGTGCAGCGCTTTGGGGACATCGTCCCC
CTGGGTGTGACCCATATGACATCCCGTGACATCGAAGTACAGGGCTTCCGCATCCCTAAG
GGAACGACACTCATCACCAACCTGTCATCGGTGCTGAAGGATGAGGCCGTCTGGGAGAAG
CCCTTCCGCTTCCACCCCGAACACTTCCTGGATGCCCAGGGCCACTTTGTGAAGCCGGAG
GCCTTCCTGCCTTTCTCAGCAGGCCGCCGTGCATGCCTCGGGGAGCCCCTGGCCCGCATG
GAGCTCTTCCTCTTCTTCACCTCCCTGCTGCAGCACTTCAGCTTCTCGGTGCCCACTGGA
CAGCCCCGGCCCAGCCACCATGGTGTCTTTGCTTTCCTGGTGACCCCATCCCCCTATGAG
CTTTGTGCTGTGCCCCGCTAG
Restriction Sites Please inquire
ACCN NM_001025161
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001025161.1, NP_001020332.1
RefSeq Size 1520 bp
RefSeq ORF 1341 bp
Locus ID 1565
UniProt ID P10635
Cytogenetics 22q13.2
Protein Families Druggable Genome, P450, Transmembrane
Protein Pathways Drug metabolism - cytochrome P450
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to metabolize as many as 25% of commonly prescribed drugs. Its substrates include antidepressants, antipsychotics, analgesics and antitussives, beta adrenergic blocking agents, antiarrythmics and antiemetics. The gene is highly polymorphic in the human population; certain alleles result in the poor metabolizer phenotype, characterized by a decreased ability to metabolize the enzyme's substrates. Some individuals with the poor metabolizer phenotype have no functional protein since they carry 2 null alleles whereas in other individuals the gene is absent. This gene can vary in copy number and individuals with the ultrarapid metabolizer phenotype can have 3 or more active copies of the gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) lacks an in-frame exon in the CDS, as compared to variant 1, which results in a shorter isoform (2).
Write Your Own Review
You're reviewing:Cytochrome P450 2D6 (CYP2D6) (NM_001025161) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221660 CYP2D6 (Myc-DDK-tagged)-Human cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6), transcript variant 2 10 ug
$457.00
RC221660L3 Lenti ORF clone of Human cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC221660L4 Lenti ORF clone of Human cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6), transcript variant 2, mGFP tagged 10 ug
$757.00
RG221660 CYP2D6 (tGFP-tagged) - Human cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6), transcript variant 2 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.