Cytochrome P450 2D6 (CYP2D6) (NM_001025161) Human Untagged Clone
SKU
SC302357
CYP2D6 (untagged)-Human cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6), transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Cytochrome P450 2D6 |
Synonyms | CPD6; CYP2D; CYP2D7AP; CYP2D7BP; CYP2D7P2; CYP2D8P2; CYP2DL1; CYPIID6; P450-DB1; P450C2D; P450DB1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_001025161 edited
ATGGGGCTAGAAGCACTGGTGCCCCTGGCCATGATAGTGGCCATCTTCCTGCTCCTGGTG GACCTGATGCACCGGCGCCAACGCTGGGCTGCACGCTACCCACCAGGCCCCCTGCCACTG CCCGGGCTGGGCAACCTGCTGCATGTGGACTTCCAGAACACACCATACTGCTTCGACCAG TTGCGGCGCCGCTTCGGGGACGTGTTCAGCCTGCAGCTGGCCTGGACGCCGGTGGTCGTG CTCAATGGGCTGGCGGCCGTGCGCGAGGCGCTGGTGACCCACGGCGAGGACACCGCCGAC CGCCCGCCTGTGCCCATCACCCAGATCCTGGGTTTCGGGCCGCGTTCCCAAGGACGCCCC TTTCGCCCCAACGGTCTCTTGGACAAAGCCGTGAGCAACGTGATCGCCTCCCTCACCTGC GGGCGCCGCTTCGAGTACGACGACCCTCGCTTCCTCAGGCTGCTGGACCTAGCTCAGGAG GGACTGAAGGAGGAGTCGGGCTTTCTGCGCGAGGTGCTGAATGCTGTCCCCGTCCTCCTG CATATCCCAGCGCTGGCTGGCAAGGTCCTACGCTTCCAAAAGGCTTTCCTGACCCAGCTG GATGAGCTGCTAACTGAGCACAGGATGACCTGGGACCCAGCCCAGCCCCCCCGAGACCTG ACTGAGGCCTTCCTGGCAGAGATGGAGAAGGCCAAGGGGAACCCTGAGAGCAGCTTCAAT GATGAGAACCTGTGCATAGTGGTGGCTGACCTGTTCTCTGCCGGGATGGTGACCACCTCG ACCACGCTGGCCTGGGGCCTCCTGCTCATGATCCTACATCCGGATGTGCAGCGCCGTGTC CAACAGGAGATCGACGACGTGATAGGGCAGGTGCGGCGACCAGAGATGGGTGACCAGGCT CACATGCCCTACACCACTGCCGTGATTCATGAGGTGCAGCGCTTTGGGGACATCGTCCCC CTGGGTGTGACCCATATGACATCCCGTGACATCGAAGTACAGGGCTTCCGCATCCCTAAG GGAACGACACTCATCACCAACCTGTCATCGGTGCTGAAGGATGAGGCCGTCTGGGAGAAG CCCTTCCGCTTCCACCCCGAACACTTCCTGGATGCCCAGGGCCACTTTGTGAAGCCGGAG GCCTTCCTGCCTTTCTCAGCAGGCCGCCGTGCATGCCTCGGGGAGCCCCTGGCCCGCATG GAGCTCTTCCTCTTCTTCACCTCCCTGCTGCAGCACTTCAGCTTCTCGGTGCCCACTGGA CAGCCCCGGCCCAGCCACCATGGTGTCTTTGCTTTCCTGGTGACCCCATCCCCCTATGAG CTTTGTGCTGTGCCCCGCTAG |
Restriction Sites | Please inquire |
ACCN | NM_001025161 |
Insert Size | 1300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001025161.1, NP_001020332.1 |
RefSeq Size | 1520 bp |
RefSeq ORF | 1341 bp |
Locus ID | 1565 |
UniProt ID | P10635 |
Cytogenetics | 22q13.2 |
Protein Families | Druggable Genome, P450, Transmembrane |
Protein Pathways | Drug metabolism - cytochrome P450 |
Summary | This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to metabolize as many as 25% of commonly prescribed drugs. Its substrates include antidepressants, antipsychotics, analgesics and antitussives, beta adrenergic blocking agents, antiarrythmics and antiemetics. The gene is highly polymorphic in the human population; certain alleles result in the poor metabolizer phenotype, characterized by a decreased ability to metabolize the enzyme's substrates. Some individuals with the poor metabolizer phenotype have no functional protein since they carry 2 null alleles whereas in other individuals the gene is absent. This gene can vary in copy number and individuals with the ultrarapid metabolizer phenotype can have 3 or more active copies of the gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (2) lacks an in-frame exon in the CDS, as compared to variant 1, which results in a shorter isoform (2). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC221660 | CYP2D6 (Myc-DDK-tagged)-Human cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6), transcript variant 2 | 10 ug |
$457.00
|
|
RC221660L3 | Lenti ORF clone of Human cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6), transcript variant 2, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC221660L4 | Lenti ORF clone of Human cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6), transcript variant 2, mGFP tagged | 10 ug |
$757.00
|
|
RG221660 | CYP2D6 (tGFP-tagged) - Human cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6), transcript variant 2 | 10 ug |
$489.00
MSRP
$657.00
MSRP
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.