RUNX2 (NM_001024630) Human Untagged Clone

SKU
SC302270
RUNX2 (untagged)-Human runt-related transcription factor 2 (RUNX2), transcript variant 1
$2,333.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RUNX2
Synonyms AML3; CBF-alpha-1; CBFA1; CCD; CCD1; CLCD; OSF-2; OSF2; PEA2aA; PEBP2aA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001024630 edited
ATGCTTCATTCGCCTCACAAACAACCACAGAACCACAAGTGCGGTGCAAACTTTCTCCAG
GAGGACAGCAAGAAGTCTCTGGTTTTTAAATGGTTAATCTCCGCAGGTCACTACCAGCCA
CCGAGACCAACAGAGTCATTTAAGGCTGCAAGCAGTATTTACAACAGAGGGTACAAGTTC
TATCTGAAAAAAAAAGGAGGGACTATGGCATCAAACAGCCTCTTCAGCACAGTGACACCA
TGTCAGCAAAACTTCTTTTGGGATCCGAGCACCAGCCGGCGCTTCAGCCCCCCCTCCAGC
AGCCTGCAGCCCGGCAAAATGAGCGACGTGAGCCCGGTGGTGGCTGCGCAACAGCAGCAG
CAACAGCAGCAGCAGCAACAGCAGCAGCAGCAGCAGCAACAGCAGCAGCAGCAGCAGGAG
GCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGCAGCTGCAGTGCCCCGG
TTGCGGCCGCCCCACGACAACCGCACCATGGTGGAGATCATCGCCGACCACCCGGCCGAA
CTCGTCCGCACCGACAGCCCCAACTTCCTGTGCTCGGTGCTGCCCTCGCACTGGCGCTGC
AACAAGACCCTGCCCGTGGCCTTCAAGGTGGTAGCCCTCGGAGAGGTACCAGATGGGACT
GTGGTTACTGTCATGGCGGGTAACGATGAAAATTATTCTGCTGAGCTCCGGAATGCCTCT
GCTGTTATGAAAAACCAAGTAGCAAGGTTCAACGATCTGAGATTTGTGGGCCGGAGTGGA
CGAGGCAAGAGTTTCACCTTGACCATAACCGTCTTCACAAATCCTCCCCAAGTAGCTACC
TATCACAGAGCAATTAAAGTTACAGTAGATGGACCTCGGGAACCCAGAAGGCACAGACAG
AAGCTTGATGACTCTAAACCTAGTTTGTTCTCTGACCGCCTCAGTGATTTAGGGCGCATT
CCTCATCCCAGTATGAGAGTAGGTGTCCCGCCTCAGAACCCACGGCCCTCCCTGAACTCT
GCACCAAGTCCTTTTAATCCACAAGGACAGAGTCAGATTACAGACCCCAGGCAGGCACAG
TCTTCCCCGCCGTGGTCCTATGACCAGTCTTACCCCTCCTACCTGAGCCAGATGACGTCC
CCGTCCATCCACTCTACCACCCCGCTGTCTTCCACACGGGGCACTGGGCTTCCTGCCATC
ACCGATGTGCCTAGGCGCATTTCAGATGATGACACTGCCACCTCTGACTTCTGCCTCTGG
CCTTCCACTCTCAGTAAGAAGAGCCAGGCAGGTGCTTCAGAACTGGGCCCTTTTTCAGAC
CCCAGGCAGTTCCCAAGCATTTCATCCCTCACTGAGAGCCGCTTCTCCAACCCACGAATG
CACTATCCAGCCACCTTTACTTACACCCCGCCAGTCACCTCAGGCATGTCCCTCGGTATG
TCCGCCACCACTCACTACCACACCTACCTGCCACCACCCTACCCCGGCTCTTCCCAAAGC
CAGAGTGGACCCTTCCAGACCAGCAGCACTCCATATCTCTACTATGGCACTTCGTCAGGA
TCCTATCAGTTTCCCATGGTGCCGGGGGGAGACCGGTCTCCTTCCAGAATGCTTCCGCCA
TGCACCACCACCTCGAATGGCAGCACGCTATTAAATCCAAATTTGCCTAACCAGAATGAT
GGTGTTGACGCTGATGGAAGCCACAGCAGTTCCCCAACTGTTTTGAATTCTAGTGGCAGA
ATGGATGAATCTGTTTGGCGACCATATTGA
Restriction Sites Please inquire
ACCN NM_001024630
Insert Size 3000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001024630.1, NP_001019801.1
RefSeq Size 5564 bp
RefSeq ORF 5553 bp
Locus ID 860
UniProt ID Q13950
Cytogenetics 6p21.1
Protein Families Druggable Genome, Transcription Factors
Summary This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Two regions of potential trinucleotide repeat expansions are present in the N-terminal region of the encoded protein, and these and other mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (1) encodes the longest isoform (a, also known as OSF2/CBFA1a). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. There are no full-length transcripts supporting this RefSeq in human; however, it is represented based on PMID: 9434946, and full-length transcript support from the mouse homolog (GeneID: 12393, AF010284.1).
Write Your Own Review
You're reviewing:RUNX2 (NM_001024630) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212884 RUNX2 (Myc-DDK-tagged)-Human runt-related transcription factor 2 (RUNX2), transcript variant 1 10 ug
$822.00
RC212884L1 Lenti ORF clone of Human runt-related transcription factor 2 (RUNX2), transcript variant 1, Myc-DDK-tagged 10 ug
$1,122.00
RC212884L2 Lenti ORF clone of Human runt-related transcription factor 2 (RUNX2), transcript variant 1, mGFP tagged 10 ug
$1,122.00
RC212884L3 Lenti ORF clone of Human runt-related transcription factor 2 (RUNX2), transcript variant 1, Myc-DDK-tagged 10 ug
$1,122.00
RC212884L4 Lenti ORF clone of Human runt-related transcription factor 2 (RUNX2), transcript variant 1, mGFP tagged 10 ug
$1,122.00
RG212884 RUNX2 (tGFP-tagged) - Human runt-related transcription factor 2 (RUNX2), transcript variant 1 10 ug
$1,022.00
SC318014 RUNX2 (untagged)-Human runt-related transcription factor 2 (RUNX2), transcript variant 1 10 ug
$824.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.