GNG10 (NM_001017998) Human Untagged Clone

SKU
SC302113
GNG10 (untagged)-Human guanine nucleotide binding protein (G protein), gamma 10 (GNG10), transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GNG10
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001017998 edited
ATGTCCTCCGGGGCTAGCGCGAGCGCCCTGCAGCGCTTGGTAGAGCAGCTCAAGTTGGAG
GCTGGCGTGGAGAGGATCAAGGTCTCTCAGGCAGCTGCAGAGCTTCAACAGTACTGTATG
CAGAATGCCTGCAAGGATGCCCTGCTGGTGGGTGTTCCAGCTGGAAGTAACCCCTTCCGG
GAGCCTAGATCCTGTGCTTTACTCTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001017998 unedited
GTACTATTTGTATACGACTCCTATAGGGCGGCCGCGAATTCGGCACCAGCTCCCCGCCCG
GCCGGGCCCAGCAGCCCCTAGGAGCCCAGCGCCGCCGCCATGTCCTCCGGGGCTAGCGCG
AGCGCCCTGCAGCGCTTGGTAGAGCAGCTCAAGTTGGAGGCTGGCGTGGAGAGGATCAAG
GTCTCTCAGGCAGCTGCAGAGCTTCAACAGTACTGTATGCAGAATGCCTGCAAGGATGCC
CTGCTGGTGGGTGTTCCAGCTGGAAGTAACCCCTTCCGGGAGCCTAGATCCTGTGCTTTA
CTCTGAAGACTCTAGGAGAGAAGTTTGCTGAGGAATGCCTTCAAGCACAAAGTGATGAAT
GACTGCCTTCAAGTCTCAAGAAAACACTTTTCCCTAACTTTTAGAGATATTTCAGCCCTT
TCCTGTGGCCTGGTCCTATAGCCAAAATCACAGATATTCATGAGTTTCTACTTGAGTGAG
AAAACTGGGTGAAGGAATAGAATTTTAAATAGTAATAACTGCTTGTTTTTTTTGTGCAAG
TACTTTTATACATAAGATAAACAAAAACCTTACCACCAAACATACCAAAATGCACCTCTT
TCATAAGTGAGTTACTAAGATTTCTATACCTGGAATATCATGTATGTTTCATTTACTGGA
TGTTTACATTTTAGGAAGGAAAATAGTTCTGTTTATTTAAACAACTGAATACTTATAAAC
TGTTGTTCCTGGAAGTTATTTATTCCATAAAAAATTTGTTCTTTTCTCATGAATTTATAA
TTCCTAAATGAAGACCAGAAAGTACAAATTGCTGGGAGGAAGATAGCTTTATTAATCAAC
TGATGTCTTGATTTTTCTAAATGGGAAGATTGCTTTATTTTTAACACTAATTATGGGAGC
AGATTCTTAGCAAACT
Restriction Sites NotI-NotI
ACCN NM_001017998
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001017998.2, NP_001017998.1
RefSeq Size 1245 bp
RefSeq ORF 207 bp
Locus ID 2790
UniProt ID P50151
Cytogenetics 9q31.3
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway
Summary Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction. Interacts with beta-1 and beta-2, but not with beta-3.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represent the longer transcript. Both variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:GNG10 (NM_001017998) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210455 GNG10 (Myc-DDK-tagged)-Human guanine nucleotide binding protein (G protein), gamma 10 (GNG10), transcript variant 1 10 ug
$150.00
RC210455L1 Lenti ORF clone of Human guanine nucleotide binding protein (G protein), gamma 10 (GNG10), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC210455L2 Lenti ORF clone of Human guanine nucleotide binding protein (G protein), gamma 10 (GNG10), transcript variant 1, mGFP tagged 10 ug
$450.00
RC210455L3 Lenti ORF clone of Human guanine nucleotide binding protein (G protein), gamma 10 (GNG10), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC210455L4 Lenti ORF clone of Human guanine nucleotide binding protein (G protein), gamma 10 (GNG10), transcript variant 1, mGFP tagged 10 ug
$450.00
RG210455 GNG10 (tGFP-tagged) - Human guanine nucleotide binding protein (G protein), gamma 10 (GNG10), transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.