DGAT2L3 (AWAT1) (NM_001013579) Human Untagged Clone

SKU
SC301790
AWAT1 (untagged)-Human acyl-CoA wax alcohol acyltransferase 1 (AWAT1)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DGAT2L3
Synonyms DGA2; DGAT2L3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001013579 edited
GTTCTGAGACTCTTTGCCTCCCTCAGGCTCCCGAGAATCATGGCTCATTCCAAGCAGCCT
AGTCACTTCCAGAGTCTGATGCTTCTGCAGTGGCCTTTGAGCTACCTTGCCATCTTTTGG
ATCTTGCAGCCATTGTTCGTCTACCTGCTGTTTACATCCTTGTGGCCGCTACCAGTGCTT
TACTTTGCCTGGTTGTTCCTGGACTGGAAGACCCCAGAGCGAGGTGGCAGGCGTTCGGCC
TGGGTAAGGAACTGGTGTGTCTGGACCCACATCAGGGACTATTTCCCCATTACGATCCTG
AAGACAAAGGACCTATCACCTGAGCACAACTACCTCATGGGGGTTCACCCCCATGGCCTC
CTGACCTTTGGCGCCTTCTGCAACTTCTGCACTGAGGCCACAGGCTTCTCGAAGACCTTC
CCAGGCATCACTCCTCACTTGGCCACGCTGTCCTGGTTCTTCAAGATCCCCTTTGTTAGG
GAGTACCTCATGGCCAAAGGTGTGTGCTCTGTGAGCCAGCCAGCCATCAACTATCTGCTG
AGCCATGGCACTGGCAACCTCGTGGGCATTGTAGTGGGAGGTGTGGGTGAGGCCCTGCAA
AGTGTGCCCAACACCACCACCCTCATCCTCCAGAAGCGCAAGGGGTTCGTGCGCACAGCC
CTCCAGCATGGGGCTCATCTGGTCCCCACCTTCACTTTTGGGGAAACTGAGGTGTATGAT
CAGGTGCTGTTCCATAAGGATAGCAGGATGTACAAGTTCCAGAGCTGCTTCCGCCGTATC
TTTGGTTTCTACTGTTGTGTCTTCTATGGACAAAGCTTCTGTCAAGGCTCCACTGGGCTC
CTGCCATACTCCAGGCCTATTGTCACTGTGGTTGGGGAGCCTCTGCCACTGCCCCAAATT
GAAAAGCCAAGCCAGGAGATGGTGGACAAATACCATGCACTTTATATGGATGCTCTGCAC
AAACTGTTCGACCAGCATAAGACCCACTATGGCTGCTCAGAGACCCAAAAGCTGTTTTTC
CTGTGAATGAAGGTACTGCATGCC
Restriction Sites Please inquire
ACCN NM_001013579
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001013579.1, NP_001013597.1
RefSeq Size 987 bp
RefSeq ORF 987 bp
Locus ID 158833
UniProt ID Q58HT5
Cytogenetics Xq13.1
Protein Families Transmembrane
Summary The protein encoded by this gene belongs to the diacylglycerol acyltransferase family. It esterifies long chain (wax) alcohols with acyl-CoA-derived fatty acids to produce wax esters. Wax esters are enriched in sebum, suggesting that this enzyme plays a central role in lipid metabolism in skin. Consistent with this observation, this protein is predominantly expressed in the sebaceous gland of the skin. [provided by RefSeq, Sep 2009]
Write Your Own Review
You're reviewing:DGAT2L3 (AWAT1) (NM_001013579) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221837 AWAT1 (Myc-DDK-tagged)-Human acyl-CoA wax alcohol acyltransferase 1 (AWAT1) 10 ug
$300.00
RC221837L3 Lenti ORF clone of Human acyl-CoA wax alcohol acyltransferase 1 (AWAT1), Myc-DDK-tagged 10 ug
$600.00
RC221837L4 Lenti ORF clone of Human acyl-CoA wax alcohol acyltransferase 1 (AWAT1), mGFP tagged 10 ug
$600.00
RG221837 AWAT1 (tGFP-tagged) - Human acyl-CoA wax alcohol acyltransferase 1 (AWAT1) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.