DGAT2L3 (AWAT1) (NM_001013579) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | DGAT2L3 |
Synonyms | DGA2; DGAT2L3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_001013579 edited
GTTCTGAGACTCTTTGCCTCCCTCAGGCTCCCGAGAATCATGGCTCATTCCAAGCAGCCT AGTCACTTCCAGAGTCTGATGCTTCTGCAGTGGCCTTTGAGCTACCTTGCCATCTTTTGG ATCTTGCAGCCATTGTTCGTCTACCTGCTGTTTACATCCTTGTGGCCGCTACCAGTGCTT TACTTTGCCTGGTTGTTCCTGGACTGGAAGACCCCAGAGCGAGGTGGCAGGCGTTCGGCC TGGGTAAGGAACTGGTGTGTCTGGACCCACATCAGGGACTATTTCCCCATTACGATCCTG AAGACAAAGGACCTATCACCTGAGCACAACTACCTCATGGGGGTTCACCCCCATGGCCTC CTGACCTTTGGCGCCTTCTGCAACTTCTGCACTGAGGCCACAGGCTTCTCGAAGACCTTC CCAGGCATCACTCCTCACTTGGCCACGCTGTCCTGGTTCTTCAAGATCCCCTTTGTTAGG GAGTACCTCATGGCCAAAGGTGTGTGCTCTGTGAGCCAGCCAGCCATCAACTATCTGCTG AGCCATGGCACTGGCAACCTCGTGGGCATTGTAGTGGGAGGTGTGGGTGAGGCCCTGCAA AGTGTGCCCAACACCACCACCCTCATCCTCCAGAAGCGCAAGGGGTTCGTGCGCACAGCC CTCCAGCATGGGGCTCATCTGGTCCCCACCTTCACTTTTGGGGAAACTGAGGTGTATGAT CAGGTGCTGTTCCATAAGGATAGCAGGATGTACAAGTTCCAGAGCTGCTTCCGCCGTATC TTTGGTTTCTACTGTTGTGTCTTCTATGGACAAAGCTTCTGTCAAGGCTCCACTGGGCTC CTGCCATACTCCAGGCCTATTGTCACTGTGGTTGGGGAGCCTCTGCCACTGCCCCAAATT GAAAAGCCAAGCCAGGAGATGGTGGACAAATACCATGCACTTTATATGGATGCTCTGCAC AAACTGTTCGACCAGCATAAGACCCACTATGGCTGCTCAGAGACCCAAAAGCTGTTTTTC CTGTGAATGAAGGTACTGCATGCC |
Restriction Sites | Please inquire |
ACCN | NM_001013579 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001013579.1, NP_001013597.1 |
RefSeq Size | 987 bp |
RefSeq ORF | 987 bp |
Locus ID | 158833 |
UniProt ID | Q58HT5 |
Cytogenetics | Xq13.1 |
Protein Families | Transmembrane |
Summary | The protein encoded by this gene belongs to the diacylglycerol acyltransferase family. It esterifies long chain (wax) alcohols with acyl-CoA-derived fatty acids to produce wax esters. Wax esters are enriched in sebum, suggesting that this enzyme plays a central role in lipid metabolism in skin. Consistent with this observation, this protein is predominantly expressed in the sebaceous gland of the skin. [provided by RefSeq, Sep 2009] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC221837 | AWAT1 (Myc-DDK-tagged)-Human acyl-CoA wax alcohol acyltransferase 1 (AWAT1) | 10 ug |
$300.00
|
|
RC221837L3 | Lenti ORF clone of Human acyl-CoA wax alcohol acyltransferase 1 (AWAT1), Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC221837L4 | Lenti ORF clone of Human acyl-CoA wax alcohol acyltransferase 1 (AWAT1), mGFP tagged | 10 ug |
$600.00
|
|
RG221837 | AWAT1 (tGFP-tagged) - Human acyl-CoA wax alcohol acyltransferase 1 (AWAT1) | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.