PLAC9 (NM_001012973) Human Untagged Clone

SKU
SC301741
PLAC9 (untagged)-Human placenta-specific 9 (PLAC9)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PLAC9
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001012973 edited
GGGAAGGGCGGCTGCGGGCAGACGCGGCGCTGCGCTCGGCCAGGCCGGCACCATGCGGCC
CCTGCTCTGCGCGCTGACCGGACTGGCCCTGCTCCGCGCCGCGGGCTCTTTGGCCGCTGC
CGAACCCTTCAGCCCTCCGCGAGGAGACTCAGCTCAGAGCACAGCGTGTGACAGACACAT
GGCTGTGCAACGCCGTCTAGATGTCATGGAGGAGATGGTAGAGAAGACCGTGGATCACCT
GGGGACAGAGGTGAAAGGCCTGCTGGGCCTGCTGGAGGAGCTGGCCTGGAACCTGCCCCC
GGGACCCTTCAGCCCCGCTCCCGACCTTCTCGGAGATGGCTTCTGAGCCCTGGAGCTGGA
GCCCAGCAGTTGGAGGTGGTGCACCTGCCAGGCAGCGCCCACAGAACCAGCCCTGTCCTC
TCGACTTCCTTCCTTAGCTTCATGTGAAATAAAAGCTATTCTGGCCAAAAAAAAAAAAAA
AA
Restriction Sites Please inquire
ACCN NM_001012973
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001012973.1, NP_001012991.1
RefSeq Size 691 bp
RefSeq ORF 294 bp
Locus ID 219348
UniProt ID Q5JTB6
Cytogenetics 10q22.3
Write Your Own Review
You're reviewing:PLAC9 (NM_001012973) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209859 PLAC9 (Myc-DDK-tagged)-Human placenta-specific 9 (PLAC9) 10 ug
$150.00
RC209859L1 Lenti ORF clone of Human placenta-specific 9 (PLAC9), Myc-DDK-tagged 10 ug
$450.00
RC209859L2 Lenti ORF clone of Human placenta-specific 9 (PLAC9), mGFP tagged 10 ug
$450.00
RC209859L3 Lenti ORF clone of Human placenta-specific 9 (PLAC9), Myc-DDK-tagged 10 ug
$450.00
RC209859L4 Lenti ORF clone of Human placenta-specific 9 (PLAC9), mGFP tagged 10 ug
$450.00
RG209859 PLAC9 (tGFP-tagged) - Human placenta-specific 9 (PLAC9) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.