IL32 (NM_001012634) Human Untagged Clone

SKU
SC301683
IL32 (untagged)-Human interleukin 32 (IL32), transcript variant 5
$330.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IL32
Synonyms IL-32alpha; IL-32beta; IL-32delta; IL-32gamma; NK4; TAIF; TAIFa; TAIFb; TAIFc; TAIFd
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001012634, the custom clone sequence may differ by one or more nucleotides
ATGTGCTTCCCGAAGGTCCTCTCTGATGACATGAAGAAGCTGAAGGCCCGAATGGTGATG
TCGAGCCTGGCAGAGCTGGAGGACGACTTCAAAGAGGGCTACCTGGAGACAGTGGCGGCT
TATTATGAGGAGCAGCACCCAGAGCTCACTCCTCTACTTGAAAAAGAAAGAGATGGATTA
CGGTGCCGAGGCAACAGATCCCCTGTCCCGGATGTTGAGGATCCCGCAACCGAGGAGCCT
GGGGAGAGCTTTTGTGACAAGGTCATGAGATGGTTCCAGGCCATGCTGCAGCGGCTGCAG
ACCTGGTGGCACGGGGTTCTGGCCTGGGTGAAGGAGAAGGTGGTGGCCCTGGTCCATGCA
GTGCAGGCCCTCTGGAAACAGTTCCAGAGTTTCTGCTGCTCTCTGTCAGAGCTCTTCATG
TCCTCTTTCCAGTCCTACGGAGCCCCACGGGGGGACAAGGAGGAGCTGACACCCCAGAAG
TGCTCTGAACCCCAATCCTCAAAATGA
Restriction Sites Please inquire
ACCN NM_001012634
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001012634.1, NP_001012652.1
RefSeq Size 897 bp
RefSeq ORF 507 bp
Locus ID 9235
UniProt ID P24001
Cytogenetics 16p13.3
Protein Families Secreted Protein
Summary This gene encodes a member of the cytokine family. The protein contains a tyrosine sulfation site, 3 potential N-myristoylation sites, multiple putative phosphorylation sites, and an RGD cell-attachment sequence. Expression of this protein is increased after the activation of T-cells by mitogens or the activation of NK cells by IL-2. This protein induces the production of TNFalpha from macrophage cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (5) lacks an alternate exon in the 5' UTR and an alternate in-frame exon within the coding region, compared to variant 1, resulting in a shorter protein (isoform C). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Write Your Own Review
You're reviewing:IL32 (NM_001012634) Human Untagged Clone
Your Rating
SKU Description Size Price
RC216101 IL32 (Myc-DDK-tagged)-Human interleukin 32 (IL32), transcript variant 5 10 ug
$330.00
RC216101L3 Lenti-ORF clone of IL32 (Myc-DDK-tagged)-Human interleukin 32 (IL32), transcript variant 5 10 ug
$630.00
RC216101L4 Lenti-ORF clone of IL32 (mGFP-tagged)-Human interleukin 32 (IL32), transcript variant 5 10 ug
$630.00
RG216101 IL32 (tGFP-tagged) - Human interleukin 32 (IL32), transcript variant 5 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.