MYLK4 (NM_001012418) Human Untagged Clone

CAT#: SC301650

Reviews ()
Write a review

MYLK4 (untagged)-Human myosin light chain kinase family, member 4 (MYLK4)



Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product images

Other products for "MYLK4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MYLK4
Synonyms SgK085
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001012418 edited
TCGGAGACAGAGGGAGACGAAAACCACACTCCAGAAAGTAGCTTAATCGGACTCACTACT
AAGATGTTAAAAGTGAAGAGGCTGGAAGAATTCAACACGTGTTATAACAGCAACCAGCTG
GAGAAAATGGCCTTTTTTCAGTGCAGGGAAGAGGTGGAGAAAGTGAAGTGTTTTCTGGAA
AAAAATTCTGGGGACCAGGATTCAAGATCTAGACATAATGAGGCGAAGGAGGTGTGGTCA
AACGCCGACCTGACGGAAAGGATGCCCGTCAAAAGCAAAAGGACATCAGCCCTCGCAGTT
GACATCCCGGCTCCTCCGGCCCCATTTGATCATCGTATTGTGACAGCCAAGCAAGGAGCG
GTCAACAGCTTCTATACTGTGAGCAAGACAGAAATCCTAGGAGGAGGGCGTTTCGGCCAG
GTTCACAAGTGTGAGGAGACGGCCACAGGTCTGAAGCTGGCAGCCAAAATCATCAAGACC
AGAGGCATGAAGGACAAGGAGGAGGTGAAGAACGAGATCAGCGTCATGAACCAGCTGGAC
CACGCGAACCTCATCCAGCTGTACGATGCCTTCGAGTCTAAGAACGACATTGTCCTGGTC
ATGGAGTATGTGGATGGTGGGGAGCTGTTTGACCGCATCATCGATGAGAGCTACAATTTG
ACGGAGCTTGATACCATCCTGTTCATGAAGCAGATATGTGAGGGGATAAGGCACATGCAT
CAGATGTACATTCTCCACTTGGACCTGAAGCCTGAGAATATCCTGTGTGTGAATCGGGAT
GCTAAGCAAATAAAAATTATTGATTTTGGATTGGCCAGAAGATACAAACCCAGAGAGAAG
CTGAAGGTGAACTTTGGAACCCCAGAATTTCTCGCCCCTGAAGTTGTGAACTATGATTTT
GTTTCATTTCCCACTGACATGTGGAGTGTGGGGGTCATCGCCTATATGCTACTTAGCGGT
TTGTCGCCTTTCCTGGGTGACAATGATGCTGAGACGCTGAACAACATCCTGGCCTGCAGG
TGGGACTTAGAGGATGAAGAATTTCAGGACATCTCGGAGGAGGCCAAGGAGTTCATCTCT
AAGCTTCTGATTAAGGAGAAGAGTTGGCGAATAAGTGCAAGCGAAGCTCTCAAGCACCCC
TGGTTGTCAGACCACAAGCTCCACTCCAGACTCAATGCCCAGAAGAAGAAGAATCGTGGC
TCTGATGCCCAGGACTTTGTGACCAAATAGTCTACAGGAGGCAGCCATTTGGAAGGAAAA
CTGCTGTGGTTGCTGCTGCTTCGAGAAAATTTTTTGAAAAATCAGCAGTTCTGATGCGTT
GACCCCTATGATGACCTGGTAGTCTTAGCAGGGGGAGCCCTCGACCCTGAATGTGAACTT
GAACTGCAGTGCCTCTGCTGCGCTCAGAGGAACACCCAGCGCTGCGGTCTGGTCTCAGGG
CGCAAACACATCCCTGCACCCGGTGGTGGTGATGTTGGGAAGATGTTTCCCTGCCATCTT
GAGATTTTTTACATTTTTTAAAAAATTTTTTGATCTTAGTCACTGGGGCAGGGGGTGCAT
TATGTCTGCCATTTCTCAAATGACTACAGCTGTGACACTTAAGATTGATTGGAGATTTTA
AAACTGGAGGATGCATTTAGAGGGAGAAAGCTACTTCCAGCCATTAGACTATGCCTTTGG
AAGGGGCAATTAGATGGCCCGAAAGAATTCTGACTCCCATGCACCCTTGGAGACTTAGTT
TCACAGACTCTGTCATTTTGATTTGGTCTGTGGTCACGTGACTACAATGGATAAATAATT
TGTTTGCTGGAACAGAAGCCGTCTTTGAATTCTCCAACAAGAGGCATCAGCCACTGTGTC
TTTCATTTATTCTGAATTGTCCCCAGCGCGCATTTTCTTCCATGCAGCTGATTCTGTTTT
TCACATCTATACTCCCTGCACCCTTCTGACTGACAGTTCATCCCCACAAAACACATTGGT
TTTGAGAGGTGATGCAAAAAGTATCTGTTTATGGTTGGTCTTTGAAATTCTGACCTTTGG
AATAATGTCAACAGTCACAACAGGTTTCCTCAAGCCCCATTTGTCAACTAAAAGAGACGG
ATCTGCACCTCCTGGAGCAAG
Restriction Sites Please inquire     
ACCN NM_001012418
Insert Size 2100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_001012418.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001012418.1, NP_001012418.1
RefSeq Size 5769 bp
RefSeq ORF 1167 bp
Locus ID 340156
UniProt ID Q86YV6
Cytogenetics 6p25.2
Protein Families Druggable Genome, Protein Kinase
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.