AFMID (NM_001010982) Human Untagged Clone

CAT#: SC301556

AFMID (untagged)-Human arylformamidase (AFMID), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AFMID
• Synonyms: FKF; KF; KFA
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC301556 representing NM_001010982
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATGGATGTGTCTGGTGTGGGTTTCCCAAGCAAGGTTCCTTGGAAGAAGATGTCTGCAGAGGAGCTGG
  AGAATCAGTACTGTCCCAGCCGATGGGTTGTCCGACTGGGAGCAGAGGAAGCCTTGAGGACCTACTCACA
  GATAGGAATTGAAGCCACCACAAGGGCCCGGGCCACCAGGAAGAGCCTGCTGCATGTCCCCTATGGAGAC
  GGCGAAGGGGAGAAAGTGGACATTTACTTCCCCGACGAGTCGTCTGAAGCCTTGCCTTTCTTCCTGTTCT
  TTCACGGAGGATACTGGCAGAGCGGAAGTAAGGATGAGTCTGCCTTCATGGTCCACCCGCTGACGGCACA
  GGGAGTGGCCGTGGTAATAGTGGCTTACGGCATCGCCCCCAAAGGCACCCTGGACCACATGGTAGACCAG
  GTGACCCGCAGCGTTGCGTTTGTCCAGAAGCGGTATCCAAGCAACAAGGGAATTTACCTGTGTGGACACT
  CAGCCGGGGCCCACCTGGCTGCCATGATGCTCCTGGCCGACTGGACCAAGCATGGGGTCACGCCCAACCT
  CAGAGGCTTTTTCCTGGTGAGTGGGGTCTTTGACCTGGAGCCCATCGTGTATACTTCACAGAACGTTGCT
  CTCCAGCTGACCCTGGAGGACGCTCAGAGGAATAGCCCCCAGCTGAAGGTGGCCCAGGCACAGCCGGTGG
  ACCCCACCTGCCGTGTGCTGGTGGTCGTGGGCCAGTTCGACTCCCCCGAATTCCACCGACAGTCCTGGGA
  GTTTTACCAGACCCTGTGTCAAGGAGAGTGGAAAGCCTCATTTGAAGAGCTCCACGATGTGGACCACTTT
  GAAATTGTTGAGAATCTGACCCAGAAGGACAACGTGCTCACCCAGATTATCTTGAAAACAATCTTCCAGT
  AG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: Please inquire
• ACCN: NM_001010982
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001010982.1, NP_001010982.1
• RefSeq Size: 1820 bp
• RefSeq ORF: 927 bp
• Locus ID: 125061
• UniProt ID: Q63HM1
• Cytogenetics: 17q25.3
• Protein Pathways: Glyoxylate and dicarboxylate metabolism, Metabolic pathways, Tryptophan metabolism
• Gene Summary: Catalyzes the hydrolysis of N-formyl-L-kynurenine to L-kynurenine, the second step in the kynurenine pathway of tryptophan degradation. Kynurenine may be further oxidized to nicotinic acid, NAD(H) and NADP(H). Required for elimination of toxic metabolites.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region compared to variant 1. The resulting protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 1.