HES5 (NM_001010926) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | HES5 |
Synonyms | bHLHb38 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF sequence for NM_001010926 edited
ATGGCCCCCAGCACTGTGGCCGTGGAGCTGCTCAGCCCCAAAGAGAAAAACCGACTGCGG AAGCCGGTGGTGGAGAAGATGCGCCGCGACCGCATCAACAGCAGCATCGAGCAGCTGAAG CTGCTGCTGGAGCAGGAGTTCGCGCGGCACCAGCCCAACTCCAAGCTGGAGAAGGCCGAC ATCCTGGAGATGGCTGTCAGCTACCTGAAGCACAGCAAAGCCTTCGTCGCCGCCGCCGGC CCCAAGAGCCTGCACCAGGACTACAGCGAAGGCTACTCGTGGTGCCTGCAGGAGGCCGTG CAGTTCCTGACGCTCCACGCCGCCAGCGACACGCAGATGAAGCTGCTGTACCACTTCCAG CGGCCCCCGGCCGCGCCCGCCGCGCCCGCCAAGGAGCCCAAGGCGCCGGGCGCCGCGCCC CCGCCCGCGCTCTCCGCCAAGGCCACCGCCGCCGCCGCCGCCGCGCACCAGCCCGCCTGC GGCCTCTGGCGGCCCTGGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001010926 |
Insert Size | 1300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001010926.1. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001010926.1, NP_001010926.1 |
RefSeq Size | 1306 bp |
RefSeq ORF | 501 bp |
Locus ID | 388585 |
UniProt ID | Q5TA89 |
Cytogenetics | 1p36.32 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS |
Protein Pathways | Notch signaling pathway |
Summary | This gene encodes a member of a family of basic helix-loop-helix transcriptional repressors. The protein product of this gene, which is activated downstream of the Notch pathway, regulates cell differentiation in multiple tissues. Disruptions in the normal expression of this gene have been associated with developmental diseases and cancer. [provided by RefSeq, Dec 2008] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC215311 | HES5 (Myc-DDK-tagged)-Human hairy and enhancer of split 5 (Drosophila) (HES5) | 10 ug |
$150.00
|
|
RC215311L1 | Lenti ORF clone of Human hairy and enhancer of split 5 (Drosophila) (HES5), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC215311L2 | Lenti ORF clone of Human hairy and enhancer of split 5 (Drosophila) (HES5), mGFP tagged | 10 ug |
$450.00
|
|
RC215311L3 | Lenti ORF clone of Human hairy and enhancer of split 5 (Drosophila) (HES5), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC215311L4 | Lenti ORF clone of Human hairy and enhancer of split 5 (Drosophila) (HES5), mGFP tagged | 10 ug |
$450.00
|
|
RG215311 | HES5 (tGFP-tagged) - Human hairy and enhancer of split 5 (Drosophila) (HES5) | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.