TRIM72 (NM_001008274) Human Untagged Clone

SKU
SC301279
TRIM72 (untagged)-Human tripartite motif containing 72 (TRIM72)
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TRIM72
Synonyms MG53
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001008274, the custom clone sequence may differ by one or more nucleotides


ATGTCGGCTGCGCCCGGCCTCCTGCACCAGGAGCTGTCCTGCCCGCTGTGCCTGCAGCTGTTCGACGCGC
CCGTGACAGCCGAGTGCGGCCACAGTTTCTGCCGCGCCTGCCTAGGCCGCGTGGCCGGGGAGCCGGCGGC
GGATGGCACCGTTCTCTGCCCCTGCTGCCAGGCCCCCACGCGGCCGCAGGCACTCAGCACCAACCTGCAG
CTGGCGCGCCTGGTGGAGGGGCTGGCCCAGGTGCCGCAGGGCCACTGCGAGGAGCACCTGGACCCGCTGA
GCATCTACTGCGAGCAGGACCGCGCGCTGGTGTGCGGAGTGTGCGCCTCACTCGGCTCGCACCGCGGTCA
TCGCCTCCTGCCTGCCGCCGAGGCCCACGCACGCCTCAAGACACAGCTGCCACAGCAGAAACTGCAGCTG
CAGGAGGCATGCATGCGCAAGGAGAAGAGTGTGGCTGTGCTGGAGCATCAGCTGGTGGAGGTGGAGGAGA
CAGTGCGTCAGTTCCGGGGGGCCGTGGGGGAGCAGCTGGGCAAGATGCGGGTGTTCCTGGCTGCACTGGA
GGGCTCCTTGGACCGCGAGGCAGAGCGTGTACGGGGTGAGGCAGGGGTCGCCTTGCGCCGGGAGCTGGGG
AGCCTGAACTCTTACCTGGAGCAGCTGCGGCAGATGGAGAAGGTCCTGGAGGAGGTGGCGGACAAGCCGC
AGACTGAGTTCCTCATGAAATACTGCCTGGTGACCAGCAGGCTGCAGAAGATCCTGGCAGAGTCTCCCCC
ACCCGCCCGTCTGGACATCCAGCTGCCAATTATCTCAGATGACTTCAAATTCCAGGTGTGGAGGAAGATG
TTCCGGGCTCTGATGCCAGCGCTGGAGGAGCTGACCTTTGACCCGAGCTCTGCGCACCCGAGCCTGGTGG
TGTCTTCCTCTGGCCGCCGCGTGGAGTGCTCGGAGCAGAAGGCGCCGCCGGCCGGGGAGGACCCGCGCCA
GTTCGACAAGGCGGTGGCGGTGGTGGCGCACCAGCAGCTCTCCGAGGGCGAGCACTACTGGGAGGTGGAT
GTTGGCGACAAGCCGCGCTGGGCGCTGGGCGTGATCGCGGCCGAGGCCCCCCGCCGCGGGCGCCTGCACG
CGGTGCCCTCGCAGGGCCTGTGGCTGCTGGGGCTGCGCGAGGGCAAGATCCTGGAGGCACACGTGGAGGC
CAAGGAGCCGCGCGCTCTGCGCAGCCCCGAGAGGCGGCCCACGCGCATTGGCCTTTACCTGAGCTTCGGC
GACGGCGTCCTCTCCTTCTACGATGCCAGCGACGCCGACGCGCTCGTGCCGCTTTTTGCCTTCCACGAGC
GCCTGCCCAGGCCCGTGTACCCCTTCTTCGACGTGTGCTGGCACGACAAGGGCAAGAATGCCCAGCCGCT
GCTGCTCGTGGGTCCCGAAGGCGCCGAGGCCTGA


Restriction Sites Please inquire
ACCN NM_001008274
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation There is 1 nucleotide difference between the OriGene clone and the NCBI reference ORF. OriGene considers these to be polymorphisms and to reflect the natural differences between individuals. These result in the substitution of 1 amino acids.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001008274.1, NP_001008275.1
RefSeq Size 2098 bp
RefSeq ORF 1434 bp
Locus ID 493829
UniProt ID Q6ZMU5
Cytogenetics 16p11.2
Summary Muscle-specific protein that plays a central role in cell membrane repair by nucleating the assembly of the repair machinery at injury sites. Specifically binds phosphatidylserine. Acts as a sensor of oxidation: upon membrane damage, entry of extracellular oxidative environment results in disulfide bond formation and homooligomerization at the injury site. This oligomerization acts as a nucleation site for recruitment of TRIM72-containing vesicles to the injury site, leading to membrane patch formation. Probably acts upstream of the Ca(2+)-dependent membrane resealing process. Required for transport of DYSF to sites of cell injury during repair patch formation. Regulates membrane budding and exocytosis. May be involved in the regulation of the mobility of KCNB1-containing endocytic vesicles (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:TRIM72 (NM_001008274) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218023 TRIM72 (Myc-DDK-tagged)-Human tripartite motif containing 72 (TRIM72) 10 ug
$457.00
RC218023L1 Lenti ORF clone of Human tripartite motif containing 72 (TRIM72), Myc-DDK-tagged 10 ug
$757.00
RC218023L2 Lenti ORF clone of Human tripartite motif containing 72 (TRIM72), mGFP tagged 10 ug
$757.00
RC218023L3 Lenti ORF clone of Human tripartite motif containing 72 (TRIM72), Myc-DDK-tagged 10 ug
$757.00
RC218023L4 Lenti ORF clone of Human tripartite motif containing 72 (TRIM72), mGFP tagged 10 ug
$757.00
RG218023 TRIM72 (tGFP-tagged) - Human tripartite motif containing 72 (TRIM72) 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.