SHISA2 (NM_001007538) Human Untagged Clone

SKU
SC301233
SHISA2 (untagged)-Human shisa homolog 2 (Xenopus laevis) (SHISA2)
$300.00
5 Days*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SHISA2
Synonyms bA398O19.2; C13orf13; hShisa; PRO28631; TMEM46; WGAR9166
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001007538 edited
ATGTGGGGCGCTCGCCGCTCGTCCGTCTCCTCATCCTGGAACGCCGCTTCGCTCCTGCAG
CTGCTGCTGGCTGCGCTGCTGGCGGCGGGGGCGAGGGCCAGCGGCGAGTACTGCCACGGC
TGGCTGGACGCGCAGGGCGTCTGGCGCATCGGCTTCCAGTGTCCCGAGCGCTTCGACGGC
GGCGACGCCACCATCTGCTGCGGCAGCTGCGCGTTGCGCTACTGCTGCTCCAGCGCCGAG
GCGCGCCTGGACCAGGGCGGCTGCGACAATGACCGCCAGCAGGGCGCTGGCGAGCCTGGC
CGGGCGGACAAAGACGGCCCCGACGGCTCGGCAGTGCCCATCTACGTGCCGTTCCTCATT
GTTGGCTCCGTGTTTGTCGCCTTTATCATCTTGGGGTCCCTGGTGGCAGCCTGTTGCTGC
AGATGTCTCCGGCCTAAGCAGGATCCCCAGCAGAGCCGAGCCCCAGGGGGTAACCGCTTG
ATGGAGACCATCCCCATGATCCCCAGTGCCAGCACCTCCCGGGGGTCGTCCTCACGCCAG
TCCAGCACAGCTGCCAGTTCCAGCTCCAGCGCCAACTCAGGGGCCCGGGCGCCCCCAACA
AGGTCACAGACCAACTGTTGCTTGCCGGAAGGGACCATGAACAACGTGTATGTCAACATG
CCCACGAATTTCTCTGTGCTGAACTGTCAGCAGGCCACCCAGATTGTGCCACATCAAGGG
CAGTATCTGCATCCCCCATACGTGGGGTACACGGTGCAGCACGACTCTGTGCCCATGACA
GCTGTGCCACCTTTCATGGACGGCCTGCAGCCTGGCTACAGGCAGATTCAGTCCCCCTTC
CCTCACACCAACAGTGAACAGAAGATGTACCCAGCGGTGACTGTATAA
Restriction Sites Please inquire
ACCN NM_001007538
Insert Size 1800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001007538.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001007538.1, NP_001007539.1
RefSeq Size 2889 bp
RefSeq ORF 888 bp
Locus ID 387914
UniProt ID Q6UWI4
Cytogenetics 13q12.13
Protein Families Transmembrane
Summary Plays an essential role in the maturation of presomitic mesoderm cells by individual attenuation of both FGF and WNT signaling.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:SHISA2 (NM_001007538) Human Untagged Clone
Your Rating
SKU Description Size Price
RC220414 SHISA2 (Myc-DDK-tagged)-Human shisa homolog 2 (Xenopus laevis) (SHISA2) 10 ug
$300.00
RC220414L1 Lenti ORF clone of Human shisa homolog 2 (Xenopus laevis) (SHISA2), Myc-DDK-tagged 10 ug
$600.00
RC220414L2 Lenti ORF clone of Human shisa homolog 2 (Xenopus laevis) (SHISA2), mGFP tagged 10 ug
$600.00
RC220414L3 Lenti ORF clone of Human shisa homolog 2 (Xenopus laevis) (SHISA2), Myc-DDK-tagged 10 ug
$600.00
RC220414L4 Lenti ORF clone of Human shisa homolog 2 (Xenopus laevis) (SHISA2), mGFP tagged 10 ug
$600.00
RG220414 SHISA2 (tGFP-tagged) - Human shisa homolog 2 (Xenopus laevis) (SHISA2) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.