HNRNPD (NM_001003810) Human Untagged Clone
SKU
SC300561
HNRNPD (untagged)-Human heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) (HNRNPD), transcript variant 4
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | HNRNPD |
Synonyms | AUF1; AUF1A; hnRNPD0; HNRPD; P37 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_001003810 edited
GCCTTTGCAGCCACGCGCGCGCCTTCCCTGTCTTGTGTGCTTCGCGAGGTAGAGCGGGCG CGCGGCAGCGGCGGGGATTACTTTGCTGCTAGTTTCGGTTCGCGGCAGCGGCGGGTGTAG TCTCGGCGGCAGCGGCGGAGACACTAGCACTATGTCGGAGGAGCAGTTCGGCGGGGACGG GGCGGCGGCAGCGGCAACGGCGGCGGTAGGCGGCTCGGCGGGCGAGCAGGAGGGAGCCAT GGTGGCGGCGACACAGGGGGCAGCGGCGGCGGCGGGAAGCGGAGCCGGGACCGGGGGCGG AACCGCGTCTGGAGGCACCGAAGGGGGCAGCGCCGAGTCGGAGGGGGCGAAGATTGACGC CAGTAAGAACGAGGAGGATGAAGGGAAAATGTTTATAGGAGGCCTTAGCTGGGACACTAC AAAGAAAGATCTGAAGGACTACTTTTCCAAATTTGGTGAAGTTGTAGACTGCACTCTGAA GTTAGATCCTATCACAGGGCGATCAAGGGGTTTTGGCTTTGTGCTATTTAAAGAATCGGA GAGTGTAGATAAGGTCATGGATCAAAAAGAACATAAATTGAATGGGAAGGTGATTGATCC TAAAAGGGCCAAAGCCATGAAAACAAAAGAGCCGGTTAAAAAAATTTTTGTTGGTGGCCT TTCTCCAGATACACCTGAAGAGAAAATAAGGGAGTACTTTGGTGGTTTTGGTGAGGTGGA ATCCATAGAGCTCCCCATGGACAACAAGACCAATAAGAGGCGTGGGTTCTGCTTTATTAC CTTTAAGGAAGAAGAACCAGTGAAGAAGATAATGGAAAAGAAATACCACAATGTTGGTCT TAGTAAATGTGAAATAAAAGTAGCCATGTCGAAGGAACAATATCAGCAACAGCAACAGTG GGGATCTAGAGGAGGATTTGCAGGAAGAGCTCGTGGAAGAGGTGGTGACCAGCAGAGTGG TTATGGGAAGGTATCCAGGCGAGGTGGTCATCAAAATAGCTACAAACCATACTAAATTAT TCCATTTGCAACTTATCCCCAACAGGTGGTGAAGCAGTATTTTCCAATTTGAAGATTCAT TTGAAGGTGGCTCCTGCCACCTGCTAATAGCAGTTCAAACTAAATTTTTTGTATCAAGTC CCTGAATGGAAGTATGACGTTGGGTCCCTCTGAAGTTTAATTCTGAGTTCTCATTAAAAG AAATTTGCTTTCATTGTTTTATTTCTTAATTGCTATGCTTCAGAATCAATTTGTGTTTTA TGCCCTTTCCCCCAGTATTGTAGAGCAAGTCTTGTGTTAAAAGCCCAGTGTGACAGTGTC ATGATGTAGTAGTGTCTTACTGGTTTTTTAATAAATCCTTTTGTTTTAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001003810 |
Insert Size | 1400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001003810.1, NP_001003810.1 |
RefSeq Size | 2053 bp |
RefSeq ORF | 864 bp |
Locus ID | 3184 |
UniProt ID | Q14103 |
Cytogenetics | 4q21.22 |
Protein Families | Druggable Genome, Transcription Factors |
Summary | This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are nucleic acid binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. It localizes to both the nucleus and the cytoplasm. This protein is implicated in the regulation of mRNA stability. Alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) lacks two alternate in-frame segments, compared to variant 1. The resulting isoform (d), also known as p37, is shorter than isoform a. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC220809 | HNRNPD (Myc-DDK-tagged)-Human heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) (HNRNPD), transcript variant 4 | 10 ug |
$300.00
|
|
RC220809L1 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) (HNRNPD), transcript variant 4, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC220809L2 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) (HNRNPD), transcript variant 4, mGFP tagged | 10 ug |
$600.00
|
|
RC220809L3 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) (HNRNPD), transcript variant 4, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC220809L4 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) (HNRNPD), transcript variant 4, mGFP tagged | 10 ug |
$600.00
|
|
RG220809 | HNRNPD (tGFP-tagged) - Human heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) (HNRNPD), transcript variant 4 | 10 ug |
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.