Claudin18 (CLDN18) (NM_001002026) Human Untagged Clone

SKU
SC300395
CLDN18 (untagged)-Human claudin 18 (CLDN18), transcript variant 2
$450.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Claudin18
Synonyms SFTA5; SFTPJ
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001002026 edited
CGACACTGTGCGCCACCATGGCCGTGACTGCCTGTCAGGGCTTGGGGTTCGTGGTTTCAC
TGATTGGGATTGCGGGCATCATTGCTGCCACCTGCATGGACCAGTGGAGCACCCAAGACT
TGTACAACAACCCCGTAACAGCTGTTTTCAACTACCAGGGGCTGTGGCGCTCCTGTGTCC
GAGAGAGCTCTGGCTTCACCGAGTGCCGGGGCTACTTCACCCTGCTGGGGCTGCCAGCCA
TGCTGCAGGCAGTGCGAGCCCTGATGATCGTAGGCATCGTCCTGGGTGCCATTGGCCTCC
TGGTATCCATCTTTGCCCTGAAATGCATCCGCATTGGCAGCATGGAGGACTCTGCCAAAG
CCAACATGACACTGACCTCCGGGATCATGTTCATTGTCTCAGGTCTTTGTGCAATTGCTG
GAGTGTCTGTGTTTGCCAACATGCTGGTGACTAACTTCTGGATGTCCACAGCTAACATGT
ACACCGGCATGGGTGGGATGGTGCAGACTGTTCAGACCAGGTACACATTTGGTGCGGCTC
TGTTCGTGGGCTGGGTCGCTGGAGGCCTCACACTAATTGGGGGTGTGATGATGTGCATCG
CCTGCCGGGGCCTGGCACCAGAAGAAACCAACTACAAAGCCGTTTCTTATCATGCCTCAG
GCCACAGTGTTGCCTACAAGCCTGGAGGCTTCAAGGCCAGCACTGGCTTTGGGTCCAACA
CCAAAAACAAGAAGATATACGATGGAGGTGCCCGCACAGAGGACGAGGTACAATCTTATC
CTTCCAAGCACGACTATGTGTAA
Restriction Sites Please inquire
ACCN NM_001002026
Insert Size 800 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001002026.2, NP_001002026.1
RefSeq Size 3350 bp
RefSeq ORF 786 bp
Locus ID 51208
UniProt ID P56856
Cytogenetics 3q22.3
Protein Families Transmembrane
Protein Pathways Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
Summary This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is upregulated in patients with ulcerative colitis and highly overexpressed in infiltrating ductal adenocarcinomas. PKC/MAPK/AP-1 (protein kinase C/mitogen-activated protein kinase/activator protein-1) dependent pathway regulates the expression of this gene in gastric cells. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (2) has an alternate 5' exon, as compared to variant 1. It encodes isoform 2, also known as isoform A2, which is of the same size but has a different N-terminus, as compared to isoform 1.
Write Your Own Review
You're reviewing:Claudin18 (CLDN18) (NM_001002026) Human Untagged Clone
Your Rating
SKU Description Size Price
RC219760 CLDN18 (Myc-DDK-tagged)-Human claudin 18 (CLDN18), transcript variant 2 10 ug
$289.00 MSRP $450.00 MSRP $450.00
RC219760L1 Lenti ORF clone of Human claudin 18 (CLDN18), transcript variant 2, Myc-DDK-tagged 10 ug
$750.00
RC219760L2 Lenti ORF clone of Human claudin 18 (CLDN18), transcript variant 2, mGFP tagged 10 ug
$750.00
RC219760L3 Lenti ORF clone of Human claudin 18 (CLDN18), transcript variant 2, Myc-DDK-tagged 10 ug
$750.00
RC219760L4 Lenti ORF clone of Human claudin 18 (CLDN18), transcript variant 2, mGFP tagged 10 ug
$750.00
RG219760 CLDN18 (tGFP-tagged) - Human claudin 18 (CLDN18), transcript variant 2 10 ug
$489.00 MSRP $650.00 MSRP $650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.