Gastrin (GAST) (NM_000805) Human Untagged Clone

SKU
SC300135
GAST (untagged)-Human gastrin (GAST)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Gastrin
Synonyms GAS
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000805 edited
GGCACCACACACCTCCCAGCTCTGCAGACGAGATGCAGCGACTATGTGTGTATGTGCTGA
TCTTTGCACTGGCTCTGGCCGCCTTCTCTGAAGCTTCTTGGAAGCCCCGCTCCCAGCAGC
CAGATGCACCCTTAGGTACAGGGGCCAACAGGGACCTGGAGCTACCCTGGCTGGAGCAGC
AGGGCCCAGCCTCTCATCATCGAAGGCAGCTGGGACCCCAGGGTCCCCCACACCTCGTGG
CAGACCCGTCCAAGAAGCAGGGACCATGGCTGGAGGAAGAAGAAGAAGCCTATGGATGGA
TGGACTTCGGCCGCCGCAGTGCTGAGGATGAGAACTAACAATCCTAGAACCAAGCTTCAG
AGCCTAGCCACCTCCCACCCCACTCCAGCCCTGTCCCCTGAAAAACTGAT
Restriction Sites Please inquire
ACCN NM_000805
Insert Size 400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000805.3.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000805.3, NP_000796.1
RefSeq Size 440 bp
RefSeq ORF 306 bp
Locus ID 2520
UniProt ID P01350
Cytogenetics 17q21.2
Protein Families Druggable Genome, Secreted Protein
Summary Gastrin is a hormone whose main function is to stimulate secretion of hydrochloric acid by the gastric mucosa, which results in gastrin formation inhibition. This hormone also acts as a mitogenic factor for gastrointestinal epithelial cells. Gastrin has two biologically active peptide forms, G34 and G17. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:Gastrin (GAST) (NM_000805) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210222 GAST (Myc-DDK-tagged)-Human gastrin (GAST) 10 ug
$150.00
RC210222L1 Lenti ORF clone of Human gastrin (GAST), Myc-DDK-tagged 10 ug
$450.00
RC210222L2 Lenti ORF clone of Human gastrin (GAST), mGFP tagged 10 ug
$450.00
RC210222L3 Lenti ORF clone of Human gastrin (GAST), Myc-DDK-tagged 10 ug
$450.00
RC210222L4 Lenti ORF clone of Human gastrin (GAST), mGFP tagged 10 ug
$450.00
RG210222 GAST (tGFP-tagged) - Human gastrin (GAST) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.