Interferon alpha 2 (IFNA2) (NM_000605) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Interferon alpha 2 |
Synonyms | IFN-alpha-2; IFN-alphaA; IFNA; IFNA2B; leIF A |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_000605 edited
CAGCATCTGCAACATCTACAATGGCCTTGACCTTTGCTTTACTGGTGGCCCTCCTGGTGC TCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGTGATCTGCCTCAAACCCACAGCCTGGGTA GCAGGAGGACCTTGATGCTCCTGGCACAGATGAGGAGAATCTCTCTTTTCTCCTGCTTGA AGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAGGCTG AAACCATCCCTGTCCTCCATGAGATGATCCAGCAGATCTTCAATCTCTTCAGCACAAAGG ACTCATCTGCTGCTTGGGATGAGACCCTCCTAGACAAATTCTACACTGAACTCTACCAGC AGCTGAATGACCTGGAAGCCTGTGTGATACAGGGGGTGGGGGTGACAGAGACTCCCCTGA TGAAGGAGGACTCCATTCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTCTATCTGA AAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTT TTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAGAAGTAAGGAATGAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000605 unedited
NNNNNNNAACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGT GATCTGCCTCAAACCCACAGCCTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATG AGGAGAATCTCTCTTTTCTCCTGCTTGAAGGACAGACATGACTTTGGATTTCCCCAGGAG GAGTTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAGATGATCCAG CAGATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTA GACAAATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATACAG GGGGTGGGGGTGACAGAGACTCCCCTGATGAAGGAGGACTCCATTCTGGCTGTGAGGAAA TACTTCCAAAGAATCACTCTCTATCTGAAAGAGAAGAAATACAGCCCTTGTGCCTGGGAG GTTGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAAGAAAGTTTA AGAAGTAAGGAATGAAAACTGGTTCAACATGGAAGGGCGAATTCAGATCTGGTACCGATA TCAAGCTTGTCGACTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGG GTGGCATCCCTGTGACCCCTCCCCATGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTG CCCACCAGCCTTGTCCTA |
Restriction Sites | Please inquire |
ACCN | NM_000605 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_000605.2, NP_000596.2 |
RefSeq Size | 1142 bp |
RefSeq ORF | 567 bp |
Locus ID | 3440 |
UniProt ID | P01563 |
Cytogenetics | 9p21.3 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Antigen processing and presentation, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Regulation of autophagy, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway |
Summary | This gene is a member of the alpha interferon gene cluster on chromosome 9. The encoded cytokine is a member of the type I interferon family that is produced in response to viral infection as a key part of the innate immune response with potent antiviral, antiproliferative and immunomodulatory properties. This cytokine, like other type I interferons, binds a plasma membrane receptor made of IFNAR1 and IFNAR2 that is ubiquitously expressed, and thus is able to act on virtually all body cells. The encoded protein is effective in reducing the symptoms and duration of the common cold and in treating many types of cancer, including some hematological malignancies and solid tumors. A deficiency of type I interferon in the blood is thought to be a hallmark of severe COVID-19 and may provide a rationale for a combined therapeutic approach. [provided by RefSeq, Aug 2020] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC221091 | IFNA2 (Myc-DDK-tagged)-Human interferon, alpha 2 (IFNA2) | 10 ug |
$289.00
MSRP
$300.00
MSRP
$300.00
|
|
RC221091L1 | Lenti ORF clone of Human interferon, alpha 2 (IFNA2), Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC221091L2 | Lenti ORF clone of Human interferon, alpha 2 (IFNA2), mGFP tagged | 10 ug |
$600.00
|
|
RC221091L3 | Lenti ORF clone of Human interferon, alpha 2 (IFNA2), Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC221091L4 | Lenti ORF clone of Human interferon, alpha 2 (IFNA2), mGFP tagged | 10 ug |
$600.00
|
|
RG221091 | IFNA2 (tGFP-tagged) - Human interferon, alpha 2 (IFNA2) | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.