Serum Amyloid A (SAA1) (NM_000331) Human Untagged Clone

SKU
SC300047
SAA1 (untagged)-Human serum amyloid A1 (SAA1), transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Serum Amyloid A
Synonyms PIG4; SAA; SAA2; TP53I4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_000331 edited
GGGCCGGCCGCGAATTCGGCCATTACGGCCGGGGAGGGACCCGCAGCCTCAAGCTACAGC
ACAGACTCAAGCACCATGAAGCTTCTCACGGGCCTGGTTTTCTGCTCCTTGGTCCTGGGT
GTCAGCAGCCGAAGCTTCTTTTCGTTCCTTGGCGAGGCTTTTGATGGGGCTCGGGACATG
TGGAGAGCCTACTCTGACATGAGAGAAGCCAATTACATCGGCTCAGACAAATACTTCCAT
GCTCGGGGGAACTATGATGCTGCCAAAAGGGGACCTGGGGGTGCCTGGGCTGCAGAAGTG
ATCAGCGATGCCAGAGAGAATATCCAGAGATTCTTTGGCCATGGTGCGGAGGACTCACTG
GCCGATCAGGCTGCCAATGAATGGGGCAGGAGTGGCAAAGACCCCAATCACTTCCGACCT
GCTGGCCTGCCTGAGAAATACTGAGCTTCCTCTTCACTCTGCTCTCAGGAGATCTGGCTG
TGAGGCCCTCAGGGCAGGGATACAAAGCGGGGAGAGGGTACACAATGGGTATCTAATAAA
TACTTAAGAAAAAAAAAAAAAAAAAAAAAAAAAAACATGTCGGCCGCC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000331 unedited
NGAGGTCGAATCTTTGTACTACGAACTCACTATAGGGNNCGGCCGCGNAATTCGGCCATT
ACGGCCGGGGAGGGACCCGCAGCCTCAACTACAGCACAGCACAAGCACCATGAAGCTTCT
CACGGGCCTGGTTTTCTGCTCCTTGGTCCTGGGTGTCAGCAGCCGAAGCTTCTTTTCGTT
CCTTGGCGAGGCTTTTGATGGGGCTCGGGACATGTGGAGAGCCTACTCTGACATGAGAGA
AGCCAATTACATCGGCTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCAA
AAGGGGACCTGGGGGTGCCTGGGCTGCAGAAGTGATCAGCGATGCCAGAGAGAATATCCA
GAGATTCTTTGGCCATGGTGCGGAGGACTCACTGGCCGATCAGGCTGCCAATGAATGGGG
CAGGAGTGGCAAAGACCCCAATCACTTCCGACCTGCTGGCCTGCCTGAGAAATACTGAGC
TTCCTCTTCACTCTGCTCTCAGGAGATCTGGCTGTGAGGCCCTCAGGGCAGGGATACAAA
GCGGGGAGAGGGTACACAATGGGTATCTAATAAATACTTAANAAAAAAAAAAAAAAANAA
AAAAAAAAACATGTTCGGCCGCCTCGGCCCTCGACTCTAGATTGCGGNCCGCGGTCATAG
CTTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCCTCTG
GCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCCTATAAAATAAAGTTGCATC
ATTTTGTCTGACTAGGTGTCCTTCTATATATTTGGGGTGGAGGGGGGTGGGTTTTGGAAC
AAGGGGCCAGTTTGGGAAAAACACCCTGTAGGCCCTGCGGGGTCTATTGGGAACCAACCT
Restriction Sites Please inquire
ACCN NM_000331
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000331.2, NP_000322.2
RefSeq Size 722 bp
RefSeq ORF 369 bp
Locus ID 6288
UniProt ID P02735
Cytogenetics 11p15.1
Summary This gene encodes a member of the serum amyloid A family of apolipoproteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors. Finally, antimicrobial activity against S. aureus and E. coli resides in the N-terminal portion of the mature protein. Alternate splicing results in multiple transcript variants that encode the same protein. A pseudogene of this gene is found on chromosome 11. [provided by RefSeq, Jul 2020]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein.
Write Your Own Review
You're reviewing:Serum Amyloid A (SAA1) (NM_000331) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210664 SAA1 (Myc-DDK-tagged)-Human serum amyloid A1 (SAA1), transcript variant 1 10 ug
$150.00
RC210664L1 Lenti ORF clone of Human serum amyloid A1 (SAA1), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC210664L2 Lenti ORF clone of Human serum amyloid A1 (SAA1), transcript variant 1, mGFP tagged 10 ug
$450.00
RC210664L3 Lenti ORF clone of Human serum amyloid A1 (SAA1), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC210664L4 Lenti ORF clone of Human serum amyloid A1 (SAA1), transcript variant 1, mGFP tagged 10 ug
$450.00
RG210664 SAA1 (tGFP-tagged) - Human serum amyloid A1 (SAA1), transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.